Frequency of HLA-B27 and its alleles in patients with Reiter syndrome: comparison with the frequency in other spondyloarthropathies and a healthy control population

This retrospective study analyzed the HLA-B*27 alleles in a group of 20 consecutive patients with the diagnosis of Reiter syndrome (RS) followed in a tertiary referral university hospital in Brazil, during the period 1990-2006, and compared the data with that observed in other patients with spondyloarthropathies followed at the same institution. Eight cases were associated to gastrointestinal infection, eight cases to previous urethritis, and four cases presented no established preceding infection. HLA-B*27 alleles were typed by polymerase chain reaction-amplified DNA hybridized with sequence-specific oligonucleotide probes (HLA-B*2701 to HLA-B*2721). They were compared to a group of 108 patients with ankylosing spondylitis (AS), 40 with undifferentiated spondyloarthropathy (uSpA) and 111 healthy controls. Among the 20 patients, 17 were HLA-B*27 positive (85%). Two HLA-B*27 alleles were observed: HLA-B*2705 (65%) and HLA-B*2702 (35%). In the other spondyloarthropathies, the observed alleles were HLA-B*2705 (90% in AS and 92.5% in uSpA), HLA-B*2702 (8% in AS and 5% in uSpA), HLA-B*2704 (1% in AS and 2.5% in uSpA) and HLA-B*2713 (1% in AS). Among the 111 healthy controls, 80% presented HLA-B*2705, followed by HLA-B*2702 in 10%, HLA-B*2703 in 6%, HLA-B*2707 in 3% and HLA-B*2713 in 1%. Concluding, in the HLA-B*27 positive patients with RS in this study there was predominance of HLA-B*2705 allele, in a lower frequency than that observed in patients with other spondyloarthropathies and healthy controls.

Benchmarking in the SWISSspine registry: results of 52 Dynardi lumbar total disc replacements compared with the data pool of 431 other lumbar disc prostheses

The SWISSspine registry is the first mandatory registry of its kind in the history of Swiss orthopaedics and it follows the principle of "coverage with evidence development". Its goal is the generation of evidence for a decision by the Swiss federal office of health about reimbursement of the concerned technologies and treatments by the basic health insurance of Switzerland. Recently, developed and clinically implemented, the Dynardi total disc arthroplasty (TDA) accounted for 10% of the implanted lumbar TDAs in the registry. We compared the outcomes of patients treated with Dynardi to those of the recipients of the other TDAs in the registry. Between March 2005 and October 2009, 483 patients with single-level TDA were documented in the registry. The 52 patients with a single Dynardi lumbar disc prosthesis implanted by two surgeons (CE and OS) were compared to the 431 patients who received one of the other prostheses. Data were collected in a prospective, observational multicenter mode. Surgery, implant, 3-month, 1-year, and 2-year follow-up forms as well as comorbidity, NASS and EQ-5D questionnaires were collected. For statistical analyses, the Wilcoxon signed-rank test and chi-square test were used. Multivariate regression analyses were also performed. Significant and clinically relevant reduction of low back pain and leg pain as well as improvement in quality of life was seen in both groups (P < 0.001 postop vs. preop). There were no inter-group differences regarding postoperative pain levels, intraoperative and follow-up complications or revision procedures with a new hospitalization. However, significantly more Dynardi patients achieved a minimum clinically relevant low back pain alleviation of 18 VAS points and a quality of life improvement of 0.25 EQ-5D points. The patients with Dynardi prosthesis showed a similar outcome to patients receiving the other TDAs in terms of postoperative low back and leg pain, complications, and revision procedures. A higher likelihood for achieving a minimum clinically relevant improvement of low back pain and quality of life in Dynardi patients was observed. This difference might be due to the large number of surgeons using other TDAs compared to only two surgeons using the Dynardi TDA, with corresponding variations in patient selection, patient-physician interaction and other factors, which cannot be assessed in a registry study.

Archaeological Discoveries on Schnidejoch and at Other Ice Sites in the European Alps

Only a few sites in the Alps have produced archaeological finds from melting ice. To date, prehistoric finds from four sites dating from the Neolithic period, the Bronze Age, and the Iron Age have been recovered from small ice patches (Schnidejoch, Lötschenpass, Tisenjoch, and Gemsbichl/Rieserferner). Glaciers, on the other hand, have yielded historic finds and frozen human remains that are not more than a few hundred years old (three glacier mummies from the 16th to the 19th century and military finds from World Wars I and II). Between 2003 and 2010, numerous archaeological finds were recovered from a melting ice patch on the Schnidejoch in the Bernese Alps (Cantons of Berne and Valais, Switzerland). These finds date from the Neolithic period, the Early Bronze Age, the Iron Age, Roman times, and the Middle Ages, spanning a period of 6000 years. The Schnidejoch, at an altitude of 2756 m asl, is a pass in the Wildhorn region of the western Bernese Alps. It has yielded some of the earliest evidence of Neolithic human activity at high altitude in the Alps. The abundant assemblage of finds contains a number of unique artifacts, mainly from organic materials like leather, wood, bark, and fibers. The site clearly proves access to high-mountain areas as early as the 5th millennium BC, and the chronological distribution of the finds indicates that the Schnidejoch pass was used mainly during periods when glaciers were retreating.

Gβ5 prevents the RGS7-Gαo interaction through binding to a distinct Gγ-like domain found in RGS7 and other RGS proteins

The G protein β subunit Gβ5 deviates significantly from the other four members of Gβ-subunit family in amino acid sequence and subcellular localization. To detect the protein targets of Gβ5 in vivo, we have isolated a native Gβ5 protein complex from the retinal cytosolic fraction and identified the protein tightly associated with Gβ5 as the regulator of G protein signaling (RGS) protein, RGS7. Here we show that complexes of Gβ5 with RGS proteins can be formed in vitro from the recombinant proteins. The reconstituted Gβ5-RGS dimers are similar to the native retinal complex in their behavior on gel-filtration and cation-exchange chromatographies and can be immunoprecipitated with either anti-Gβ5 or anti-RGS7 antibodies. The specific Gβ5-RGS7 interaction is determined by a distinct domain in RGS that has a striking homology to Gγ subunits. Deletion of this domain prevents the RGS7-Gβ5 binding, although the interaction with Gα is retained. Substitution of the Gγ-like domain of RGS7 with a portion of Gγ1 changes its binding specificity from Gβ5 to Gβ1. The interaction of Gβ5 with RGS7 blocked the binding of RGS7 to the Gα subunit Gαo, indicating that Gβ5 is a specific RGS inhibitor.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

No other choice but co-operation. The background of Lithuania's and Latvia's relations with Belarus. OSW Commentary No. 99, 2013-01-04

For years now Belarus has been a key economic partner for Lithuania and Latvia. These two Baltic states have well-developed port infrastructure and thus provide what are the geographically closest and also the cheapest exit to international outlets for Belarusia’s petrochemical and chemical industries, both of which are export-oriented. As a result, the transit of Belarusian goods is one of the major sources of income for the state budgets of the two countries. This economic interdependence has affected the stance Riga and Vilnius take on Minsk at the EU forum. When in February and March 2012 the Council of the European Union was resolving the issue of imposing economic sanction on selected Belarusian companies which backed Alyaksandr Lukashenka’s regime, this triggered a discussion on what the point of such measures is and on possible economic losses in Lithuania and Latvia. As a result of firm resistance from Latvia (which was backed by Slovenia), the Council removed those companies which were most strongly engaged in co-operation with Latvian partners from the list of those to be covered with economic sanctions. Lithuania, which is more critical of the political situation in Belarus, did not express its official opposition to the sanctions. Despite some differences in the policies adopted by Riga and Vilnius, it turned out that Minsk could count on strong support from local business groups in both of these countries, as these groups fear impediments in this highly profitable co-operation and also retaliation from the Belarusian government. The existing economic bonds mean that neither Vilnius nor Riga have any other choice but to co-operate with Belarus. They must therefore adopt a carefully balanced policy towards Minsk. At the same time, being EU member states, they do not officially deny that a problem exists with the violation of human rights by Alyaksandr Lukashenka’s regime. It is for this reason that the governments of Latvia and Lithuania will be interested in maintaining the status quo in relations with Minsk. On the other hand, Belarus in a way also has no other choice but to use the ports in Lithuania and Latvia, and this will prevent it from excessively escalating tension in relations with these two countries.

Concentration of mannitol and other soluble carbohydrates in the crustose lichen Rhizocarpon geographicum

In symbiotic lichens which have Trebouxia as the algal partner, photosynthesis by the algae results in the production of the soluble carbohydrate ribitol which is then transported to the fungus where it is converted to arabitol and mannitol. Within the fungus, arabitol may act as a short-term carbohydrate reserve while mannitol may have a more protective function and be important in stress resistance. The concentrations of ribitol, arabitol, and mannitol were measured, using gas chromatography, in the central areolae and marginal hypothallus of the crustose lichen Rhizocarpon geographicum (L.) DC. growing on slate rocks in north Wales, UK. The concentrations of all three soluble carbohydrates were greater in the central areolae than in the marginal prothallus. In addition, the ratio of mannitol in the prothallus to that in the areolae was least in July. The concentration of an individual carbohydrate in the prothallus was correlated primarily with the concentrations of the other carbohydrates in the prothallus and not to their concentrations in the areolae. Low concentration of ribitol, arabitol, and mannitol in the marginal prothallus compared with the central areolae suggests either a lower demand for carbohydrate by the prothallus or limited transport from areolae to prothallus and may explain the low growth rates of this species. In addition, soluble carbohydrates appear to be partitioned differently through the year with an increase in mannitol compared with arabitol in more stressful periods.

The influence of fathers and other significant male figures on girls' well -being and achievement in early adolescence

Changes in the demographic structure of American families have highlighted the need to reevaluate fatherhood. Research illustrates that paternal involvement positively affects child development, but father absence has increased due to rising rates of divorce, cohabitation, and non-marital childbirth. There is evidence that other male figures can function as effective father surrogates. However, information is limited, particularly with respect to female development. ^ This study examined differences in well-being, achievement, and paternal support among girls in four father categories: (a) Biological Father, (b) Step-Father, (c) Surrogate Father, and (d) No Father. Maternal support, economic hardship, and life stressors were included as potential covariates. Interviews were conducted with an ethnically and economically diverse sample of 694 sixth and eighth grade children. The sample included boys to assess the extent to which the findings were unique to girls. Measures included quantitative and qualitative support from father figures and indices of self-esteem, loneliness, and depression. Standardized test scores and classroom grades were also obtained from school records. ^ Girls with biological fathers had higher achievement test scores than girls in the other father categories, but there were no other differences related to the presence or absence of a father-figure. Biological fathers also provided greater quantitative and qualitative support than step- and surrogate fathers. Surrogate fathers provided a greater amount but lower quality of support than step-fathers. ^ Girls who received lower levels of support from biological fathers reported lower self-esteem and greater loneliness, compared to fatherless girls and those receiving low support from other father figures, suggesting that low support from biological fathers may be especially distressing. On the other hand, girls with low biological father support had higher achievement scores compared to fatherless girls and those who received low support from step- and surrogate fathers. Thus, the mere presence of the biological father appears to facilitate achievement, regardless of the level of support he provides. ^ This study highlights the supportive characteristics of different father figures and their influence on well-being and achievement in females. Future research should focus on the dynamics of surrogate father relationships and the specific characteristics that differentially affect developmental outcomes. ^

Derivation of base-line geochemistry, petrography, and isotopic data for the host rocks to the Lucky Strike deposit and comparison with data from other alteration zones, Buchans Mining Camp, Newfoundland

The Buchans ore bodies of central Newfoundland represent some of the highest grade VMS deposits ever mined. These Kuroko-type deposits are also known for the well developed and preserved nature of the mechanically transported deposits. The deposits are hosted in Cambro-Ordovician, dominantly calc-alkaline, bimodal volcanic and epiclastic sequences of the Notre Dame Subzone, Newfoundland Appalachians. Stratigraphic relationships in this zone are complicated by extensively developed, brittledominated Silurian thrust faulting. Hydrothermal alteration of host rocks is a common feature of nearly all VMS deposits, and the recognition of these zones has been a key exploration tool. Alteration of host rocks has long been described to be spatially associated with the Buchans ore bodies, most notably with the larger in-situ deposits. This report represents a base-line study in which a complete documentation of the geochemical variance, in terms of both primary (igneous) and alteration effects, is presented from altered volcanic rocks in the vicinity of the Lucky Strike deposit (LSZ), the largest in-situ deposit in the Buchans camp. Packages of altered rocks also occur away from the immediate mining areas and constitute new targets for exploration. These zones, identified mostly by recent and previous drilling, represent untested targets and include the Powerhouse (PHZ), Woodmans Brook (WBZ) and Airport (APZ) alteration zones, as well as the Middle Branch alteration zone (MBZ), which represents a more distal alteration facies related to Buchans ore-formation. Data from each of these zones were compared to those from the LSZ in order to evaluate their relative propectivity. Derived litho geochemical data served two functions: (i) to define primary (igneous) trends and (ii) secondary alteration trends. Primary trends were established using immobile, or conservative, elements (i. e., HFSE, REE, Th, Ti0₂, Al₂0₃, P₂0₅). From these, altered volcanic rocks were interpreted in terms of composition (e.g., basalt - rhyodacite) and magmatic affinity (e.g., calc-alkaline vs. tholeiitic). The information suggests that bimodality is a common feature of all zones, with most rocks plotting as either basalt/andesite or dacite (or rhyodacite); andesitic senso stricto compositions are rare. Magmatic affinities are more varied and complex, but indicate that all units are arc volcanic sequences. Rocks from the LSZ/MBZ represent a transitional to calc-alkalic sequence, however, a slight shift in key geochemical discriminants occurs between the foot-wall to the hanging-wall. Specifically, mafic and felsic lavas of the foot-wall are of transitional (or mildly calc-alkaline) affinity whereas the hanging-wall rocks are relatively more strongly calc-alkaline as indicated by enriched LREE/HREE and higher ZrN, NbN and other ratios in the latter. The geochemical variations also serve as a means to separate the units (at least the felsic rocks) into hanging-wall and foot-wall sequences, therefore providing a valuable exploration tool. Volcanic rocks from the WBZ/PHZ (and probably the APZ) are more typical of tholeiitic to transitional suites, yielding flatter mantlenormalized REE patterns and lower ZrN ratios. Thus, the relationships between the immediate mining area (represented by LSZ/MBZ) and the Buchans East (PHZ/WBZ) and the APZ are uncertain. Host rocks for all zones consist of mafic to felsic volcanic rocks, though the proportion of pyroclastic and epiclastic rocks, is greatest at the LSZ. Phenocryst assemblages and textures are common in all zones, with minor exceptions, and are not useful for discrimination purposes. Felsic rocks from all zones are dominated by sericiteclay+/- silica alteration, whereas mafic rocks are dominated by chlorite- quartz- sericite alteration. Pyrite is ubiquitous in all moderately altered rocks and minor associated base metal sulphides occur locally. The exception is at Lucky Strike, where stockwork quartzveining contains abundant base-metal mineralization and barite. Rocks completely comprised of chlorite (chloritite) also occur in the LSZ foot-wall. In addition, K-feldspar alteration occurs in felsic volcanic rocks at the MBZ associated with Zn-Pb-Ba and, notably, without chlorite. This zone represents a peripheral, but proximal, zone of alteration induced by lower temperature hydrothermal fluids, presumably with little influence from seawater. Alteration geochemistry was interpreted from raw data as well as from mass balanced (recalculated) data derived from immobile element pairs. The data from the LSZ/MBZ indicate a range in the degree of alteration from only minor to severe modification of precursor compositions. Ba tends to show a strong positive correlation with K₂0, although most Ba occurs as barite. With respect to mass changes, Al₂0₃, Ti0₂ and P₂0₅ were shown to be immobile. Nearly all rocks display mass loss of Na₂O, CaO, and Sr reflecting feldspar destruction. These trends are usually mirrored by K₂0-Rb and MgO addition, indicating sericitic and chloritic alteration, respectively. More substantial gains ofK₂0 often occur in rocks with K-feldspar alteration, whereas a few samples also displayed excessive MgO enrichment and represent chloritites. Fe₂0₃ indicates both chlorite and sulphide formation. Si0₂ addition is almost always the case for the altered mafic rocks as silica often infills amygdules and replaces the finer tuffaceous material. The felsic rocks display more variability in Si0₂. Silicic, sericitic and chloritic alteration trends were observed from the other zones, but not K-feldspar, chloritite, or barite. Microprobe analysis of chlorites, sericites and carbonates indicate: (i) sericites from all zones are defined as muscovite and are not phengitic; (ii) at the LSZ, chlorites ranged from Fe-Mg chlorites (pycnochlorite) to Mg-rich chlorite (penninite), with the latter occurring in the stockwork zone and more proximal alteration facies; (iii) chlorites from the WBZ were typical of those from the more distal alteration facies of the LSZ, plotting as ripidolite to pycnochlorite; (iv) conversely, chlorite from the PHZ plot with Mg-Al-rich compositions (chlinochlore to penninite); and (v) carbonate species from each zone are also varied, with calcite occurring in each zone, in addition to dolomite and ankerite in the PHZ and WBZ, respectively. Lead isotope ratios for galena separates from the different various zones, when combined with data from older studies, tend to cluster into four distinctive fields. Overall, the data plot on a broad mixing line and indicate evolution in a relatively low-μ environment. Data from sulphide stringers in altered MBZ rocks, as well as from clastic sulphides (Sandfill prospect), plot in the Buchans ore field, as do the data for galena from altered rocks in the APZ. Samples from the Buchans East area are even more primitive than the Buchans ores, with lead from the PHZ plotting with the Connel Option prospect and data from the WBZ matching that of the Skidder prospect. A sample from a newly discovered debris flow-type sulphide occurrence (Middle Branch East) yields lead isotope ratios that are slightly more radiogenic than Buchans and plot with the Mary March alteration zone. Data within each cluster are interpreted to represent derivation from individual hydrothermal systems in which metals were derived from a common source.

The psychometric properties of the brief Other as Shamer Scale for Children (OAS‐C) : preliminary validation studies in a sample of Portuguese children

Shame is a social emotion with adaptive functions involved in human be-havior and social interactions. This emotion is regarded as an involuntary response associated with increased self-awareness, loss of status and self-devaluation (Gilbert, 1998), that may render individuals more prone to psychopathology (Gilbert, 1998; Pinto-Gouveia & Matos, 2011). Thus, identifying and assessing feelings of shame in childhood is essential in addressing the actual impact of shame on individual’s developmental trajectory. The Other As Shamer Scale (OAS; Goss, Gilbert & Allan, 1994) is a widely used measure of external shame, adapted and translated to several languages — including Portuguese (Matos, Pinto-Gouveia, Gilbert, Duarte & Figueiredo, 2015) — to adult and to adolescent populations (OASB-A - Other As Shamer Brief for adolescents; translated and adapted by Cunha, Xavier, Cherpe & Pinto-Gouveia, 2014). The current study aims to adapt and to explore the psychometric proper-ties of the brief OAS in a sample of Portuguese children attending to elementary schools.

An Efficient Protocol For The Generation Of Monocyte Derived Dendritic Cells Using Serum-free Media For Clinical Applications In Post Remission Aml Patients.

Protocols for the generation of dendritic cells (DCs) using serum as a supplementation of culture media leads to reactions due to animal proteins and disease transmissions. Several types of serum-free media (SFM), based on good manufacture practices (GMP), have recently been used and seem to be a viable option. The aim of this study was to evaluate the results of the differentiation, maturation, and function of DCs from Acute Myeloid Leukemia patients (AML), generated in SFM and medium supplemented with autologous serum (AS). DCs were analyzed by phenotype characteristics, viability, and functionality. The results showed the possibility of generating viable DCs in all the conditions tested. In patients, the X-VIVO 15 medium was more efficient than the other media tested in the generation of DCs producing IL-12p70 (p=0.05). Moreover, the presence of AS led to a significant increase of IL-10 by DCs as compared with CellGro (p=0.05) and X-Vivo15 (p=0.05) media, both in patients and donors. We concluded that SFM was efficient in the production of DCs for immunotherapy in AML patients. However, the use of AS appears to interfere with the functional capacity of the generated DCs.

[the Sociology Of Health In Brazil - The Creation Of An Identity].

This article analyzes the historical, social and cognitive dimensions of the sociology of medicine in the construction of its identity, from Wolf Lepenies' perspective. It is understood that the construction of an identity does not end with the first historical manifestations, but is consolidated when it is institutionalized and structured as a field of knowledge by creating its own forms of cognitive expression. The text is divided into three parts: in the first the precursors are presented, highlighting the role played by some travelers, naturalists and folklore scholars, followed by social physicians-scientists and the first social scientists (1940-1969). In the second part, aspects of the consolidation of the social sciences in health are presented at two significant moments, namely the 1970s and 1980s. In the third part, the issues raised by the field are addressed in general terms. It is considered that once the main structural stages are in place there is still a need for the formation of new generations of social scientists in health. It is also essential to disseminate scientific production and to ensure that the relations are studied in depth and institutionalized with the sociological matrices on the one hand and with the field of health on the other.

Evaluation Of The Radiopacity Of Esthetic Root Canal Posts.

The radiopacity of esthetic root canal posts may impair the assessment of their fit to the root canal when using radiographic images. This study determined in vitro the radiographic density of esthetic root canal posts using digital images. Thirty-six roots of human maxillary canines were assigned to six groups (N=6 per group): Reforpost (RP); Aestheti-Plus (AP); Reforpost MIX (RPM); D.T. Light Post (LP); Reforpost Radiopaque (RPR); and White Post DC (WP). Standardized digital images of the posts were obtained in different conditions: outside the root canal, inside the canal before and after cementation using luting material, and with a tissue simulator. Analysis of variance was used to compare the radiopacity mean values among the posts outside the root canal and among the posts under the other conditions, and the t unpaired test to compare the radiopacity between the posts and the dentin, and between the posts and the root canal space. There was no statistically significant difference in radiopacity between RP and RPM, and LP and WP. AP posts showed radiopacity values significantly lower than those for dentin. No statistically significant difference was found between posts (RP and AP) and the root canal space. A statistically significant difference was observed between the luted and non-luted posts; additionally, luted posts with and without tissue simulator showed no significant differences. Most of the cement-luted posts analyzed in this study were distinguishable from the density of adjacent dentin surfaces, allowing radiographic confirmation of the fit of the post in the canal. The success of using esthetic root canal posts depends mainly on the fit of the post within the canal.[1] The radiopacity of a post allows for radiographic imaging to be used to determine the fit, an important factor in a clinical perspective.

Visual Navigation In The Neotropical Ant Odontomachus Hastatus (formicidae, Ponerinae), A Predominantly Nocturnal, Canopy-dwelling Predator Of The Atlantic Rainforest.

The arboreal ant Odontomachus hastatus nests among roots of epiphytic bromeliads in the sandy forest at Cardoso Island (Brazil). Crepuscular and nocturnal foragers travel up to 8m to search for arthropod prey in the canopy, where silhouettes of leaves and branches potentially provide directional information. We investigated the relevance of visual cues (canopy, horizon patterns) during navigation in O. hastatus. Laboratory experiments using a captive ant colony and a round foraging arena revealed that an artificial canopy pattern above the ants and horizon visual marks are effective orientation cues for homing O. hastatus. On the other hand, foragers that were only given a tridimensional landmark (cylinder) or chemical marks were unable to home correctly. Navigation by visual cues in O. hastatus is in accordance with other diurnal arboreal ants. Nocturnal luminosity (moon, stars) is apparently sufficient to produce contrasting silhouettes from the canopy and surrounding vegetation, thus providing orientation cues. Contrary to the plain floor of the round arena, chemical cues may be important for marking bifurcated arboreal routes. This experimental demonstration of the use of visual cues by a predominantly nocturnal arboreal ant provides important information for comparative studies on the evolution of spatial orientation behavior in ants. This article is part of a Special Issue entitled: Neotropical Behaviour.

Perception Of Oral And Maxillofacial Surgeons, Orthodontists And Laypersons In Relation To The Harmony Of The Smile.

Harmony is one of the main objectives in surgical and orthodontic treatment and this harmony must be present in the smile, as well as in the face. The aim of the present study was to assess the perceptions of professionals and laypersons in relation to the harmony of the smile of patients with or without vertical maxillary alterations. Sixty observers (oral and maxillofacial surgeons, orthodontists and laypersons) reported the degree of harmony of six smiles using an objective questionnaire and the participants indicated if there was a need for corrective surgery or not. The classification of observers was recorded on a Likert scale from 1 to 5. Mixed regression was used to determine differences between the three groups. Statistically significant differences were found only for the harmony of the smile between the oral and maxillofacial surgeons and laypersons, with laypersons being more critical when assessing the smile. There was no statistical difference between the other groups for the harmony of the smile or the indication of corrective surgery. The patterns of greater or lesser harmony determined by observers during the smile were similar to those found in the literature as the ideal standard in relation to vertical maxillary positioning. Laypersons had a tendency to be more critical in relation to facial harmony than surgeons, although no statistical differences were found in the other groups in relation to the harmony of the smile or indication for the corrective surgery. In addition, the patterns of greater or lesser harmony of the smile determined by the participants were similar to those found in the literature as the ideal standard in relation to vertical maxillary positioning. Overall, the present study demonstrates that adequate interaction between surgeons, orthodontists and laypersons is essential in order to achieve facial harmony with orthodontic and/or surgical treatment. Opinion of specialists and laypersons about the smile in relation to the vertical positioning of the maxilla.