Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

A novel X-ray rheometer for in situ studies of polymer melts and solutions during shear flow

A novel X-ray rheometer based on a parallel plate geometry is described. This system allows time-resolved X-ray scattering intensity data to be obtained from polymeric samples subjected to shear flow. The range of quantitative structural parameters, such as molecular orientation and inter chain correlations, which can be obtained from the data is highlighted. Examples of the utility of X-ray scattering in examining optically opaque samples and the extraction of 〈P2〉 and 〈P4〉 orientation parameters are given using anisotropic hydroxypropylcellulose solutions as the sample.

Science and medicine

This is the first ‘Science and Medicine’ chapter in The Year’s Work in Critical and Cultural Theory. It is synchronised with the journal’s other chapters in its reviewing of works published in 2010, while it also reads these works in the broader context of rapidly expanding interdisciplinary areas of research. Scientific and medical vocabularies are (to use a scientific metaphor) cross-pollinating within many areas of scholarship in the humanities, and this current period is bringing many exciting developments. This chapter concentrates on literary studies, while forthcoming chapters will also look more squarely at cultural studies.

Secondary school students’ epistemic insight into the relationships between science and religion – a preliminary enquiry

A number of previous studies have shown that there is a widespread view among young people that science and religion are opposed. In this paper, we suggest that it requires a significant level of what can be termed ‘epistemic insight’ to access the idea that some people see science and religion as compatible while others do not. To explore this further, we draw on previous work to devise a methodology to discover students’ thinking about apparent contradictions between scientific and religious explanations of the origins of the universe. In our discussion of the findings, we highlight that students’ epistemic insight in this context does seem in many cases to be limited and we outline some of the issues emerging from the study that seem to boost or limit students’ progress in this area.