The systematics and biology of the south African gall-inducing scale insect, Calycicoccus merwei brain (Hemiptera : Coccoidea : Eriococcidae)

The scale insect genus Calycicoccus Brain has a single described species, C. merwei Brain, which is endemic to southeastern South Africa. Females of C. merwei induce small, mostly conical galls on the foliage of their host tree, Apodytes dimidiata E. Meyer ex Arn. (Icacinaceae), which has a wider, mostly coastal distribution, than that currently known for the scale insect. Calycicoccus has been placed in the family Eriococcidae and may be related to the South American genus Aculeococcus Lepage. No other native eriococcid species have been described so far in South Africa, although the family is diverse in other Gondwanan regions. This paper summarizes the biology of C. merwei, redescribes the adult female, describes the adult male, the second-instar female and the first-instar nymphs for the first time, and reconsiders the phylogenetic relationships of the genus. The adult female is shown to have unusual abdominal segmentation, in that segment I is present both dorsally and ventrally, but a segment is absent ventrally on the middle abdomen. First-instar nymphs are sexually dimorphic; males have a larger and relatively narrower body, larger mouthparts, longer antennae and legs, and more thoracic dorsal setae compared with females. Molecular data from nuclear small-subunit ribosomal DNA (18S) and elongation factor 1 alpha (EF-1a) show C. merwei to have no close relatives among the Eriococcidae sampled to date. Instead, the Calycicoccus lineage is part of a polytomy near the base of the Eriococcidae. Molecular dating of the node suggests that the Calycicoccus lineage diverged from other eriococcids more than 100 Mya. These data support the placement of Calycicoccus as the only genus in the subfamily Calycicoccinae Brain.

Leishmania (Viannia) braziliensis identification by PCR in the state of Para, Brazil

The incidence of cutaneous leishmaniasis (CL) is increasing and there is limited surveillance of Leishmania species throughout the world. We identified the species associated with CL in a region of Amazonia, an area recognized for its Leishmania species variability. Clinical findings were analyzed and correlated with the species identified in 93 patients. PCR assays were based on small subunit ribosomal DNA (SSU-rDNA) and G6PD, and were performed in a laboratory located 3,500 km away. Leishmania (V.) braziliensis was identified in 53 patients (57%). The other 40 patients (43%) carried a different species (including six cases of L (L) amazonensis). Molecular methods can be employed, using special media, to allow transport to distant laboratories. L (V.) braziliensis is the most common species in the area of Para. The location of ulcers can suggest CL species (C) 2010 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

Identification and characterization of a G protein-coupled receptor homolog encoded by murine cytomegalovirus

This report describes the identification of a murine cytomegalovirus (MCMV) G protein-coupled receptor (GCR) homolog. This open reading frame (M33) is most closely related to, and collinear with, human cytomegalovirus UL33, and homologs are also present in human herpesvirus 6 and 7 (U12 for both viruses). Conserved counterparts in the sequenced alpha- or gammaherpesviruses have not been identified to date, suggesting that these genes encode proteins which are important for the biological characteristics of betaherpesviruses. We have detected transcripts for both UL33 and M33 as early as 3 or 4 h postinfection, and these reappear at late times. In addition, we have identified N-terminal splicing for both the UL33 and M33 RNA transcripts. For both open reading frames, splicing results in the introduction of amino acids which are highly conserved among known GCRs. To characterise the function of the M33 in the natural host, two independent MCMV recombinant viruses were prepared, each of which possesses an M33 open reading frame which has been disrupted with the beta-galactosidase gene. While the recombinant M33 null viruses showed no phenotypic differences in replication from wild-type MCMV in primary mouse embryo fibroblasts in vitro, they showed severely restricted growth in the salivary glands of infected mice. These data suggest that M33 plays an important role in vivo, in particular in the dissemination to or replication in the salivary gland, and provide the first evidence for the function of a viral GCR homolog in vivo.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The phylogeography of African Brazilians

Background/Aims: Approximately four million Africans were taken as slaves to Brazil, where they interbred extensively with Amerindians and Europeans. We have previously shown that while most White Brazilians carry Y chromosomes of European origin, they display high proportions of African and Amerindian mtDNA lineages, because of sex-biased genetic admixture. Methods: We studied the Y chromosome and mtDNA haplogroup structure of 120 Black males from Sao Paulo, Brazil. Results: Only 48% of the Y chromosomes, but 85% of the mtDNA haplogroups were characteristic of sub-Saharan Africa, confirming our previous observation of sexually biased mating. We mined literature data for mtDNA and Y chromosome haplogroup frequencies for African native populations from regions involved in Atlantic Slave Trade. Principal Components Analysis and Bayesian analysis of population structure revealed no genetic differentiation of Y chromosome marker frequencies between the African regions. However, mtDNA examination unraveled considerable genetic structure, with three clusters at Central-West Africa, West Africa and Southeast Africa. A hypothesis is proposed to explain this structure. Conclusion: Using these mtDNA data we could obtain for the first time an estimate of the relative ancestral contribution of Central-West (0.445), West (0.431) and Southeast Africa (0.123) to African Brazilians from Sao Paulo. These estimates are consistent with historical information. Copyright (c) 2008 S. Karger AG, Basel.

Lipopolysaccharide biosynthesis genes in koala type I Chlamydia: Cloning and characterization

We showed in 1988 that there are two strains of Chlamydia psittaci which infect the koala (Phascolarctos cinereus). In order to further investigate the role of these chlamydial strains in pathogenesis, we have attempted to identify genes of koala type I strain chlamydial which are involved in the immunogenic response, Transformation of Escherichia coli with a plasmid containing a 6.3-kb fragment (pKOC-10) of C. psittaci DNA caused the appearance of a specific chlamydial lipopolysaccharide (LPS) epitope on the host strain. The smallest DNA fragment capable of inducing the expression of chlamydial LPS was an Xbal fragment, 2.4 kb in size (pKOC-5). DNA sequence analysis of the complete fragment revealed regions of high identity, at the amino acid level, to the gseA genes of C. pneomoniae, C. psittaci 6BC and C. trachomatis, and the kdtA gene of E. coli which code for transferases catalysing the addition of 3-deoxy-D-manno-octulosonic acid (Kdo) residues to lipid A. Two open reading frames (ORFs) of 1,314 and 501 nucleotides in size, within the 2.4-kb fragment, were evident, and mRNA species corresponding to these ORFs were detected by Northern analysis. Both ORF1 and ORF2 are required for the appearance of chlamydia-specific LPS on the surface of recombinant E. coli.

Oral cavity is not a reservoir for Helicobacter pylori in infected patients with functional dyspepsia

Helicobacter pylori infection is very prevalent in Brazil, infecting almost 65% of the population. The aim of this study was to evaluate the presence of this bacterium in the oral cavity of patients with functional dyspepsia (epigastric pain syndrome), establish the main sites of infection in the mouth, and assess the frequency of cagA and vacA genotypes of oral H. pylori. All 43 outpatients with epigastric pain syndrome, who entered the study, were submitted to upper gastrointestinal endoscopy to rule out organic diseases. Helicobacter pylori infection in the stomach was confirmed by a rapid urease test and urea breath tests. Samples of saliva, the tongue dorsum and supragingival dental plaque were collected from the oral cavity of each subject and subgingival dental plaque samples were collected from the patients with periodontitis; H. pylori infection was verified by polymerase chain reaction using primers that amplify the DNA sequence of a species-specific antigen present in all H. pylori strains; primers that amplify a region of urease gene, and primers for cagA and vacA (m1, m2, s1a, s1b, s2) genotyping. Thirty patients harbored H. pylori in the stomach, but it was not possible to detect H. pylori in any oral samples using P1/P2 and Urease A/B. The genotype cagA was also negative in all samples and vacA genotype could not be characterized (s-m-). The oral cavity may not be a reservoir for H. pylori in patients with epigastric pain syndrome, the bacterium being detected exclusively in the stomach.

Immunohistochemistry and polymerase chain reaction on paraffin-embedded material improve the diagnosis of cutaneous leishmaniasis in the Amazon region

Background Recently, there has been an increase in the incidence of cutaneous leishmaniasis (CL), which represents an important health problem. This increase may be related to the epidemiologic expansion of the infective agent and the increase in tourism in tropical areas. The difficulty in clinical diagnosis, mainly in areas in which CL is not the first consideration of local physicians, has intensified efforts to describe diagnostic tests, which should be specific, sensitive, and practical. Amongst the new tests described are those including nucleic acid amplification (polymerase chain reaction, PCR) and immunohistochemistry (IHC). Methods In this study, we evaluated the sensitivity of a PCR based on small subunit (SSU) ribosomal DNA, in comparison with IHC using Leishmania spp. antibodies, in biopsies embedded in paraffin. Result The results indicated a total sensitivity of 96% (90.9% with PCR and 68.8% with IHC), showing the possibility of using paraffin-embedded biopsies to diagnose CL. Conclusion We propose the use of the two tests together as a routine protocol for diagnosis. This would require the provision of local medical services to perform molecular biology techniques and adequate Leishmania antibodies.

Molecular evidence of human T-cell lymphotropic virus types 1 and 2 (HTLV-1 and HTLV-2) infections in HTLV seroindeterminate individuals from Sao Paulo, Brazil

Background: Using enzyme immunoassays and Western blot (Wb) tests, HTLV serodiagnosis yields indeterminate results in a significant number of cases. Objective: To determine the prevalence of HTLV infection among HTLV-seroindeterminate individuals. Study design: We studied peripheral blood mononuclear cells from 65 anti-HTLV Wb-seroindeterminate individuals by attempting to amplify proviral DNA sequences (tax and pot) to identify HTLV-I and HTLV-2 infections. Results: These 65 specimens exhibited predominantly (43%) anti-HTLV antibodies to gag-coded antigens in the absence of anti-p24 on Wb analysis. Tax proviral sequences were detected in 6 (9.2%) samples. According to restricted fragment polymorphism analysis (RFLP), we identified HTLV-1 proviral DNA in 4 samples. HTLV-2 in one and sequences from both in another. Nested PCR for the pot region was positive in 3 (4.6%) specimens, which were also positive for tax sequences. After hybridization HTLV-1 infection was confirmed in 2 samples (3.1%) and HTLV-2 in another (1.5%). Detection of a single HTLV DNA sequence may be due to infection by defective provirus, but its significance remains undefined. In this cohort, no Wb reactivity pattern was predictive of proviral detection. HTLV-I infection was demonstrated in an individual who had Wb reactivity to gag-coded antigens only. Conclusions: This emphasizes the importance of clinical and laboratory follow-up of HTLV-seroindeterminate individuals from endemic areas. (c) 2009 Elsevier B.V. All rights reserved.

Matrix metalloproteinase-2 polymorphism is associated with prognosis in prostate cancer

Objective: Prostate cancer (PCa) is the most frequent tumor in males in Brazil. Single nucleotide polymorphisms (SNP) have been demonstrated in the promoter region of matrix metalloproteinases (MMPs) genes and have been associated with development and progression of some cancers. In this study, our aim was to investigate a possible relation between polymorphism of the promoter region of the MMP2 gene and classical prognostic parameters in prostate cancer. Materials and methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by real-time polymerase chain reaction, using fluorescent probes (TaqMan). Results: In patients with tumors of a higher stage (pT3), a polymorphic allele in the MMP2 gene was more frequent (P = 0.026) than in patients with lower tumor stage. A polymorphic allele in the MMP2 gene was more frequent in Gleason >= 7 than in Gleason <= 6 (P = 0.042). Conclusions: We conclude that MMP2 polymorphism can be used together with pathological stage and Gleason score to identify patients with worse prognosis. Our results illustrate the potential use of MMP2 SNP as a molecular marker for prostate cancer. (C) 2010 Elsevier Inc. All rights reserved.

Genetic Polymorphisms of Matrix Metalloproteinases: Susceptibility and Prognostic Implications for Prostate Cancer

Purpose: Prostate cancer is the most common tumor in males in Brazil. Single nucleotide polymorphisms have been demonstrated to exist in the promoter regions of matrix metalloproteinase genes and they are associated with the development and progression of some cancers. We investigated the correlation between MMP1, 2, 7 and 9 polymorphisms with susceptibility to prostate cancer, and classic prognostic parameters of prostate cancer. Materials and Methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by realtime polymerase chain reaction using TaqMan (R) fluorescent probes. Results: For the MMP1 gene the polymorphic allele was more common in the control group than in the prostate cancer group (p <0.001). For the MMP9 gene the incidence of the polymorphic homozygote genotype was higher in the prostate cancer group (p <0.001). For higher stage tumors (pT3) a polymorphic allele in the MMP2 gene was more common (p = 0.026). When considering Gleason score, the polymorphic homozygote genotype of MMP9 was more common in Gleason 6 or less tumors (p = 0.003), while a polymorphic allele in the MMP2 gene was more common in Gleason 7 or greater tumors (p = 0.042). Conclusions: MMP1 and MMP2 may protect against prostate cancer development and MMP9 may be related to higher risk. In contrast, MMP9 polymorphism was associated with a lower Gleason score and MMP2 polymorphism was associated with nonorgan confined disease.

The 434(G > C) polymorphism in the eosinophil cationic protein gene and its association with tissue eosinophilia in oral squamous cell carcinomas

Objective: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G > C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic variables. Methods: The ECP genotypes of 165 healthy individuals and 157 OSCC patients were detected by PCR-RFLP analysis after cleavage of the amplified DNA sequence with enzyme PstI. TATE was obtained by morphometric analysis. Chi-square test or Fisher`s exact test was used to analyze the association of ECP-gene polymorphism 434(G > C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test. Results: Most of healthy individuals (53.33%) and OSCC patients (57.97%) were heterozygous for the ECP 434(G > C) polymorphism. Based on numerical differences, our results showed that OSCC patients with intense TATE and at least one C allele had a higher frequency of bilateral neck dissection, local recurrence, vascular embolization, involved resection margins, and postoperative radiotherapy. No statistically significant differences on survival rates were found in OSCC patients presenting different ECP 434(G > C) genotypes. Conclusions: These results suggest a tendency towards a poor clinical outcome in OSCC patients with intense TATE and 434GC/CC genotypes, probably due to an ECP genetic variant with altered cytotoxic activity.

Numerous gene rearrangements in the mitochondrial genome of the wallaby louse, Heterodoxus macropus (Phthiraptera)

The complete arrangement of genes in the mitochondrial (mt) genome is known for 12 species of insects, and part of the gene arrangement in the mt genome is known for over 300 other species of insects. The arrangement of genes in the mt genome is very conserved in insects studied, since all of the protein-coding and rRNA genes and most of the tRNA genes are arranged in the same way. We sequenced the entire mt genome of the wallaby louse, Heterodoxus macropus, which is 14,670 bp long and has the 37 genes typical of animals and some noncoding regions. The largest noncoding region is 73 bp long (93% A+T), and the second largest is 47 bp long (92% AST). Both of these noncoding regions seem to be able to form stem-loop structures. The arrangement of genes in the mt genome of this louse is unlike that of any other animal studied. All tRNA genes have moved and/or inverted relative to the ancestral gene arrangement of insects, which is present in the fruit fly Drosophila yakuba. At least nine protein-coding genes (atp6, atp8, cox2, cob, nad1-nad3, nad5, and nad6) have moved; moreover, four of these genes (atp6, atp8, nad1, and nad3) have inverted. The large number of gene rearrangements in the mt genome of H. macropus is unprecedented for an arthropod.

Analysis of the TGF beta functional pathway in epithelial ovarian carcinoma

Epithelial ovarian carcinoma is often diagnosed at an advanced stage of disease and is the leading cause of death from gynaecological neoplasia. The genetic changes that occur during the development of this carcinoma are poorly understood. It has been proposed that IGFIIR, TGF beta1 and TGF beta RII act as a functional unit in the TGF beta growth inhibitory pathway, and that somatic loss-of-function mutations in any one of these genes could lead to disruption of the pathway and subsequent loss of cell cycle control. We have examined these 3 genes in 25 epithelial ovarian carcinomas using single-stranded conformational polymorphism analysis and DNA sequence analysis. A total of 3 somatic missense mutations were found in the TGF beta RII gene, but none in IGFRII or TGF beta1. An association was found between TGF beta RII mutations and histology, with 2 out of 3 clear cell carcinomas having TGF beta RII mutations. This data supports other evidence from mutational analysis of the PTEN and beta -catenin genes that there are distinct developmental pathways responsible for the progression of different epithelial ovarian cancer histologic subtypes. (C) 2001 Cancer Research Campaign.