967 resultados para Reserve Site Selection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose - The purpose of this paper is to verify if Brazilian companies are adopting environmental requirements in the supplier selection process. Further, this paper intends to analyze whether there is a relation between the level of environmental management maturity and the inclusion of environmental criteria in the companies` selection of suppliers. Design/methodology/approach - A review of mainstream literature on environmental management, traditional criteria in the supplier selection process and the incorporation of environmental requirements in this context. The empirical study`s strategy is based on five Brazilian case studies with industrial companies. Face-to-face interviews and informal conversations are to be held, explanations made by e-mail with representatives from the purchasing, environmental management, logistics and other areas, and observation and the collection of company documents are also employed. Findings - Based on the cases, it is concluded that companies still use traditional criteria to select suppliers, such as quality and cost, and do not adopt environmental requirements in the supplier selection process in a uniform manner. Evidence found shows that the level of environmental management maturity influences the depth with which companies adopt environmental criteria when selecting suppliers. Thus, a company with more advanced environmental management adopts more formal procedures for selecting environmentally appropriate suppliers than others. Originality/value - This is the first known study to verify if Brazilian companies are adopting environmental requirements in the supplier selection process.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

It is well known that the optimal auction-one that maximizes the seller's expected revenue-can be implemented using a standard auction format with a suitably chosen reserve price. This reserve price is above the seller's value of retaining the object and the mechanism requires a commitment not to sell the object below the reserve. This commitment is what makes the reserve valuable to the seller. However, in practice, a reserve price commits the seller to sell the object if the reserve is reached, but does not commit her to withhold the object from sale if bidding falls short of the reserve. In this note we investigate whether reserve prices remain valuable for the seller when she may negotiate with the highest bidder if the reserve is not met. We show that the value of the reserve price may be completely undermined if the seller is a sufficiently weak bargainer. (c) 2004 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Whenever we plan, imagine, or observe an action, the motor systems that would be involved in preparing and executing that action are similarly engaged. The way in which such common motor activation is formed, however, is likely to differ depending on whether it arises from our own intentional selection of action or from the observation of another's action. In this study, we use time-resolved event-related functional MRI to tease apart neural processes specifically related to the processing of observed actions, the selection of our own intended actions, the preparation for movement, and motor response execution. Participants observed a finger gesture movement or a cue indicating they should select their own finger gesture to perform, followed by a 5-s delay period; participants then performed the observed or self-selected action. During the preparation and readiness for action, prior to initiation, we found activation in a common network of higher motor areas, including dorsal and ventral premotor areas and the pre-supplementary motor area (pre-SMA); the more caudal SMA showed greater activation during movement execution. Importantly, the route to this common motor activation differed depending on whether participants freely selected the actions to perform or whether they observed the actions performed by another person. Observation of action specifically involved activation of inferior and superior parietal regions, reflecting involvement of the dorsal visual pathway in visuomotor processing required for planning the action. In contrast, the selection of action specifically involved the dorsal lateral prefrontal and anterior cingulate cortex, reflecting the role of these prefrontal areas in attentional selection and guiding the selection of responses. (c) 2005 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Abnormal heart-rate (HR) response during or after a graded exercise test has been recognized as a strong and an independent predictor of all-cause mortality in healthy and diseased subjects. The purpose of the present study was to evaluate the HR response during exercise in women with systemic lupus erythematosus (SLE). In this case-control study, 22 women with SLE (age 29.5 perpendicular to 1.1 years) were compared with 20 gender-, BMI-, and age-matched healthy subjects (age 26.5 +/- 1.4 years). A treadmill cardiorespiratory test was performed and HR response during exercise was evaluated by the chronotropic reserve (CR). HR recovery (Delta HRR) was defined as the difference between HR at peak exercise and at both first (Delta HRR1) and second (Delta HRR2) minutes after exercising. SLE patients presented lower peak VO(2) when compared with healthy subjects (27.6 perpendicular to 0.9 vs. 36.7 perpendicular to 1.1 ml/kg/min, p = 0.001, respectively). Additionally, SLE patients demonstrated lower CR (71.8 +/- 2.4 vs. 98.2 +/- 2.6%, p = 0.001), Delta HRR1 (22.1 +/- 2.5 vs. 32.4 +/- 2.2%, p = 0.004) and Delta HRR2 (39.1 +/- 2.9 vs. 50.8 +/- 2.5%, p = 0.001) than their healthy peers. In conclusion, SLE patients presented abnormal HR response to exercise, characterized by chronotropic incompetence and delayed Delta HRR. Lupus (2011) 20, 717-720.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Two humanized monoclonal antibody constructs bearing the same variable regions of an anti-CD3 monoclonal antibody, whole IgG and FvFc, were expressed in CHO cells. Random and site-specific integration were used resulting in similar expression levels. The transfectants were selected with appropriate selection agent, and the surviving cells were plated in semi-solid medium for capture with FITC-conjugated anti-human IG antibody and picked with the robotic ClonePix FL. Conditioned media from selected clones were purified by affinity chromatography and characterized by SDS-PAGE, Western-blot, SEC-HPLC, and isoelectric focusing. Binding to the target present in healthy human mononuclear cells was assessed by flow cytometry, as well as by competition between the two constructs and the original murine monoclonal antibody. The humanized constructs were not able to dislodge the murine antibody while the murine anti-CD3 antibody could dislodge around 20% of the FvFc or IgG humanized versions. Further in vitro and in vivo pre-clinical analyses will be carried out to verify the ability of the humanized versions to demonstrate the immunoregulatory profile required for a humanized anti-CD3 monoclonal antibody.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Exercise training has been shown to be effective in improving exercise capacity and quality of life in patients with heart failure and left ventricular (LV) systolic dysfunction. Real-time myocardial contrast echocardiography (RTMCE) is a new technique that allows quantitative analysis of myocardial blood flow (MBF). The aim of this study was to determine the effects of exercise training on MBF in patients with LV dysfunction. We studied 23 patients with LV dysfunction who underwent RTMCE and cardiopulmonary exercise testing at baseline and 4 months after medical treatment (control group, n = 10) or medical treatment plus exercise training (trained group, n = 13). Replenishment velocity (0) and MBF reserves were derived from quantitative RTMCE. The 4-month exercise training consisted of 3 60-minute exercise sessions/week at an intensity corresponding to anaerobic threshold, 10% below the respiratory compensation point. Aerobic exercise training did not change LV diameters, volumes, or ejection fraction. At baseline, no difference was observed in MBF reserve between the control and trained groups (1.89, 1.67 to 1.98, vs 1.81, 1.28 to 2.38, p = 0.38). Four-month exercise training resulted in a significant increase in beta reserve from 1.72 (1.45 to 1.48) to 2.20 (1.69 to 2.77, p <0.001) and an MBF reserve from 1.81 (1.28 to 2.38) to 3.05 (2.07 to 3.93, p <0.001). In the control group, 13 reserve decreased from 1.51 (1.10 to 1.85) to 1.46 (1.14 to 2.33, p = 0.03) and MBF reserve from 1.89 (1.67 to 1.98) to 1.55 (1.11 to 2.27, p <0.001). Peak oxygen consumption increased by 13.8% after 4 months of exercise training and decreased by 1.9% in the control group. In conclusion, exercise training resulted in significant improvement of MBF reserve in patients with heart failure and LV dysfunction. (C) 2010 Elsevier Inc. All rights reserved. (Am J Cardiol 2010;105:243-248)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The study investigated the social rules applicable to selection interviews, and the attributions ions made by interviewers in response to rule-breaking behaviours by candidates. Sixty personnel specialists (31 males and 29 females) participated in the main study which examined their perceptions of social rules and attributions about rule breaking in their work experience. They listened to audiotapes of actual selection interviews, and made judgments about hireability communication competence, and specific social rules. Results indicated that interview rules could be categorized into two groups: specific interview presentation skills and general interpersonal competence. While situational attributions were more salient in explaining the breaking of general interpersonal competence rules, internal attributions (ability, effort) were more salient explanations for the breaking of more specific interview rules (with the exception of the preparation rule where lack of effort was the most likely explanation for rule breaking). Candidates previously judged as competent communicators were rated more favourably on both global and specific measures of rule-following competence, as well as on hireability. The theoretical and practical implications of combining social rules and attribution theory in the study of selection interviews are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fifty-four Large White gilts were used to determine the effect of body composition at selection (145 d of age) on the onset of puberty and subsequent reproductive development until 202 d of age. Gilts were assigned to one of three groups based on their backfat depth at selection: 10 to 12 mm (L), 13 to 15 mm (M), and 16 to 18 mm (F). All of the F gilts, 92% of the M gilts, and 67% of the L gilts reached puberty by slaughter at 202 d of age. Data from a subgroup (first 67% to reach puberty in each group; L = Lp, M = Mp, and F = Fp) was also used. The M (Mp) and F (Fp) gilts reached puberty at 172 d (166 d) and 170 d (166 d) of age, respectively, but the L (Lp) gilts at 184.5 d were 12 d (18 d) older than M(P < .05), Mp(P < .001), and F(P < .01), Fp (P < .001) gilts. The Lp (97.68 kg) and Mp (98.33 kg) gilts were lighter (P < .01) than Fp (108.72 kg) gilts at puberty. There were no differences (P < .05) among the L, M, and F gilts in terms of backfat depth or weight at puberty. The L (Lp) gilts had a mean of 1.16 (1.75) estrous cycles, which was lower (P < .01) than for M (Mp) and (P < .01) F (Fp) gilts, with 1.96 (2.29) and 2.25 (2.33) cycles, respectively. L (Lp) gilts had fewer (P < .05) follicles, 13.14 (12.63), than either M (Mp), 19.08 (18.71), or F (Fp), 18.25 (17.42) gilts. The number of corpora lutea was not influenced (P > .05) by grouping at selection, but Fp gilts had fewer (P < .05) corpora lutea than Mp or Fp gilts. Live weight at slaughter was not influenced (P > .10) by grouping at selection or subgrouping at puberty. The L gilts with a mean of 18.05 mm of backfat at slaughter were leaner (P < .05) than the F (21.66 mm) but not (P > .10) the M gilts (19.41 mm). Subgrouping had no effect. Fat deposition and protein deposition were higher (P < .05) in those animals that attained puberty. We conclude that the rate of fat and protein deposition seems to be one of the determinants of puberty attainment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

H-1 NMR spectra of the thyroid hormone thyroxine recorded at low temperature and high field show splitting into two peaks of the resonance due to the H2,6 protons of the inner (tyrosyl) ring. A single resonance is observed in 600 MHz spectra at temperatures above 185 K. An analysis of the line shape as a function of temperature shows that the coalescence phenomenon is due to an exchange process with a barrier of 37 kJ mol(-1). This is identical to the barrier for coalescence of the H2',6' protons of the outer (phenolic) ring reported previously for the thyroid hormones and their analogues. It is proposed that the separate peaks at low temperature are due to resonances for H2,6 in cisoid and transoid conformers which are populated in approximately equal populations. These two peaks are averaged resonances for the individual H2 and H6 protons. Conversion of cisoid to transoid forms can occur via rotation of either the alanyl side chain or the outer ring, from one face of the inner ring to the other. It is proposed that the latter process is the one responsible for the observed coalescence phenomenon. The barrier to rotation of the alanyl side chain is greater than or equal to 37 kJ mol(-1), which is significantly larger than has previously been reported for Csp(2)-Csp(3) bonds in other Ph-CH2-X systems. The recent crystal structure of a hormone agonist bound to the ligand-binding domain of the rat thyroid hormone receptor (Wagner et al. Nature 1995, 378, 690-697) shows the transoid form to be the bound conformation. The significant energy barrier to cisoid/transoid interconversion determined in the current study combined with the tight fit of the hormone to its receptor suggests that interconversion between the forms cannot occur at the receptor site but that selection for the preferred bound form occurs from the 50% population of the transoid form in solution.