Molecular epidemiological studies on genetic predispositions to squamous cell carcinoma of the head and neck

Two molecular epidemiological studies were conducted to examine associations between genetic variation and risk of squamous cell carcinoma of the head and neck (SCCHN). In the first study, we hypothesized that genetic variation in p53 response elements (REs) may play roles in the etiology of SCCHN. We selected and genotyped five polymorphic p53 REs as well as a most frequently studied p53 codon 72 (Arg72Pro, rs1042522) polymorphism in 1,100 non-Hispanic White SCCHN patients and 1,122 age-and sex-matched cancer-free controls recruited at The University of Texas M. D. Anderson Cancer Center. In multivariate logistic regression analysis with adjustment for age, sex, smoking and drinking status, marital status and education level, we observed that the EOMES rs3806624 CC genotype had a significant effect of protection against SCCHN risk (adjusted odds ratio= 0.79, 95% confidence interval =0.64–0.98), compared with the -838TT+CT genotypes. Moreover, a significantly increased risk associated with the combined genotypes of p53 codon 72CC and EOMES -838TT+CT was observed, especially in the subgroup of non-oropharyneal cancer patients. The values of false-positive report probability were also calculated for significant findings. In the second study, we assessed the association between SCCHN risk and four potential regulatory single nucleotide polymorphisms (SNPs) of DEC1 (deleted in esophageal cancer 1) gene, a candidate tumor suppressor gene for esophageal cancer. After adjustment for age, sex, and smoking and drinking status, the variant -606CC (i.e., -249CC) homozygotes had a significantly reduced SCCHN risk (adjusted odds ratio = 0.71, 95% confidence interval = 0.52–0.99), compared with the -606TT homozygotes. Stratification analyses showed that a reduced risk associated with the -606CC genotype was more pronounced in subgroups of non-smokers, non-drinkers, younger subjects (defined as ≤ 57 years), carriers of TP53 Arg/Arg (rs1042522) genotype, patients with oropharyngeal cancer or late-stage SCCHN. Further in silico analysis revealed that the -249 T-to-C change led to a gain of a transcription factor binding site. Additional functional analysis showed that the -249T-to-C change significantly enhanced transcriptional activity of the DEC1 promoter and the DNA-protein binding activity. We conclude that the DEC1 promoter -249 T>C (rs2012775) polymorphism is functional, modulating susceptibility to SCCHN among non-Hispanic Whites. Additional large-scale, preferably population-based studies are needed to validate our findings.^

IMMUNOLOGICAL MECHANISMS OF EXTRACORPOREAL PHOTOPHERESIS IN CUTANEOUS T CELL LYMPHOMA AND GRAFT VERSUS HOST DISEASE

IMMUNOLOGICAL MECHANISMS OF EXTRACORPOREAL PHOTOPHERESIS IN CUTANEOUS T CELL LYMPHOMA AND GRAFT VERSUS HOST DISEASE Publication No.___________ Lisa Harn-Ging Shiue, B.S. Supervisory Professor: Madeleine Duvic, M.D. Extracorporeal photopheresis (ECP) is an effective, low-risk immunomodulating therapy for leukemic cutaneous T cell lymphoma (L-CTCL) and graft versus host disease (GVHD), but whether the mechanism(s) of action in these two diseases is (are) identical or different is unclear. To determine the effects of ECP in vivo, we studied regulatory T cells (T-regs), cytotoxic T lymphocytes (CTLs), and dendritic cells (DCs) by immunofluorescence flow cytometry in 18 L-CTCL and 11 GVHD patients before and after ECP at Day 2, 1 month, 3 months, and 6 months. In this study, ECP was effective in 12/18 L-CTCL patients with a 66.7% overall response rate (ORR) and 6/11 GVHD patients with a 54.5% ORR. Prior to ECP, the percentages of CD4+Foxp3+ T cells in 9 L-CTCL patients were either lower (L-CTCL-Low, n=2) or higher (L-CTCL-High, n=7) than normal. Five of the 7 GVHD patients had high percentages of CD4+Foxp3+ T cells (GVHD-High). Six of 7 L-CTCL-High patients had >80% CD4+Foxp3+ T cells which were correlated with tumor cells, and were responders. Both L-CTCL-High and GVHD-High patients had decreased percentages of CD4+Foxp3+ and CD4+Foxp3+CD25- T cells after 3 months of treatment. CD4+Foxp3+CD25+ T cells increased in GVHD-High patients but decreased in L-CTCL-High patients after 3 months of ECP. In addition, numbers of CTLs were abnormal. We confirmed that numbers of CTLs were low in L-CTCL patients, but high in GVHD patients prior to ECP. After ECP, CTLs increased after 1 month in 4/6 L-CTCL patients whereas CTLs decreased after 6 months in 3/3 GVHD patients. Myeloid (mDCs) and plasmacytoid DCs (pDCs) were also low at baseline in L-CTCL and GVHD patients confirming the DC defect. After 6 months of ECP, numbers and percentages of mDCs and pDCs increased in L-CTCL and GVHD. MDCs were favorably increased in 8/12 L-CTCL responders whereas pDCs were favorably increased in GVHD patients. These data suggest that ECP is favorably modulating the DC subsets. In L-CTCL patients, the mDCs may orchestrate Th1 cell responses to overcome immune suppression and facilitate disease regression. However, in GVHD patients, ECP is favorably down-regulating the immune system and may be facilitating immune tolerance to auto-or allo-antigens. In both L-CTCL and GVHD patients, DCs are modulated, but the T cell responses orchestrated by the DCs are different, suggesting that ECP modulates depending on the immune milieu. _______________

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Growth regulatory role of R -PTPmu in normal and neoplastic epithelial cells

Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^

The role of Ski/Sno oncoproteins as negative regulators of the TGF-beta/SMAD signaling pathway in B -cell non -Hodgkin's lymphoma (NHL-B)

Non-Hodgkin's lymphomas are common tumors of the human immune system, primarily of B cell lineage (NHL-B). Negative growth regulation in the B cell lineage is mediated primarily through the TGF-β/SMAD signaling pathway that regulates a variety of tumor suppressor genes. Ski was originally identified as a transforming oncoprotein, whereas SnoN is an isoform of the Sno protein that shares a large region of homology with Ski. In this study, we show that Ski/SnoN are endogenously over-expressed both in patients' lymphoma cells and NHL-B cell lines. Exogenous TGF-β1 treatment induces down-regulation of Ski and SnoN oncoprotein expression in an NHL-B cell line, implying that Ski and SnoN modulate the TGF-β signaling pathway and are involved in cell growth regulation. Furthermore, we have developed an NHL-B cell line (DB) that has a null mutation in TGF-β receptor type II. In this mutant cell line, Ski/SnoN proteins are not down-regulated in response to TGF-β1 treatment, suggesting that downregulation of Ski and SnoN proteins in NHL-B require an intact functional TGF-β signaling pathway Resting normal B cells do not express Ski until activated by antigens and exogenous cytokines, whereas a low level of SnoN is also present in peripheral blood Go B cells. In contrast, autonomously growing NHL-B cells over-express Ski and SnoN, implying that Ski and SnoN are important cell cycle regulators. To further investigate a possible link between reduction of the Ski protein level and growth inhibition, Ski antisense oligodeoxynucleotides were transfected into NHL-B cells. The Ski protein level was found to decrease to less than 40%, resulting in restoring the effect of TGF-β and leading to cell growth inhibition and G1 cell cycle arrest. Co-immunoprecipitation experiments demonstrated that Ski associates with Smad4 in the nucleus, strongly suggesting that over-expression of the nuclear protein Ski and/or SnoN negatively regulates the TGF-β pathway, possibly by modulating Smad-mediated tumor suppressor gene expression. Together, in NHL-B, the TGF-β/SMAD growth inhibitory pathway is usually intact, but over-expression of the Ski and/or SnoN, which binds to Smad4, abrogates the negative regulatory effects of TGF-β/SMAD in lymphoma cell growth and potentiates the growth potential of neoplastic B cells. ^

Molecular mechanisms involved in the regulation of cell polarity and genome stability by the p21 -activated kinase, Shk1, in the fission yeast, Schizosaccharomyces pombe

The essential p21-activated kinase (PAK), Shk1, is a critical component of a Ras/Cdc42/PAK complex required for cell viability, normal cell polarity, proper regulation of cytoskeletal dynamics, and sexual differentiation in the fission yeast, Schizosaccharomyces pombe. While cellular functions of PAKs have been described in eukaryotes from yeasts to mammals, the molecular mechanisms of PAK regulation and function are poorly understood. This study has characterized a novel Shk1 inhibitor, Skb15, and, in addition, identified the cell polarity regulator, Tea1, as a potential biological substrate of Shk1 in S. pombe. Skb15 is a highly conserved WD repeat protein that was discovered from a two-hybrid screen for proteins that interact with the catalytic domain of Shk1. Molecular data indicate that Skb15 negatively regulates Shk1 kinase activity in S. pombe cells. A null mutation in the skb15 gene is lethal and results in deregulation of actin polymerization and localization, microtubule biogenesis, and the cytokinetic machinery, as well as a substantial uncoupling of these processes from the cell cycle. Loss of Skb15 function is suppressed by partial loss of Shk1, demonstrating that negative regulation of Shk1 by Skb15 is required for proper execution of cytoskeletal remodeling and cytokinetic functions. A mouse homolog of Skb15 can substitute for its counterpart in fission yeast, demonstrating that Skb15 protein function has been substantially conserved through evolution. ^ Our laboratory has recently demonstrated that Shk1, in addition to regulating actin cytoskeletal organization, is required for proper regulation of microtubule dynamics in S. pombe cells. The Shk1 protein localizes to interphase and mitotic microtubules, the septum-forming region, and cell ends. This pattern of localization overlaps with that of the cell polarity regulator, Tea1, in S. pombe cells. The tea1 gene was identified by Paul Nurse's laboratory from a screen for genes involved in the control of cell morphogenesis in S. pombe. In contrast to wild type S. pombe cells, which are rod shaped, tea1 null cells are often bent and/or branched in shape. The Tea1 protein localizes to the cell ends, like Shk1, and the growing tips of interphase microtubules. Thus, experiments were performed to investigate whether Tea1 interacts with Shk1. The tea1 null mutation strongly suppresses the loss of function of Skb15, an essential inhibitor of Shk1 function. All defects associated with the skb15 mutation, including defects in F-actin organization, septation, spindle elongation, and chromosome segregation, are suppressed by tea1Δ, suggesting that Tea1 may function in these diverse processes. Consistent with a role for Tea1 in cytokinesis, tea1Δ cells have a modest cell separation defect that is greatly exacerbated by a shk1 mutation and, like Shk1, Tea1 localizes to the septation site. Molecular analyses showed that Tea1 phosphorylation is significantly dependent on Shk1 function in vivo and that bacterially expressed Tea1 protein is directly phosphorylated by recombinant Shk1 kinase in vitro. Taken together, these results identify Tea1 as a potential biological substrate of Shk1 in S. pombe. ^ In summary, this study provides new insights into a conserved regulatory mechanism for PAKs, and also begins to uncover the molecular mechanisms by which the Ras/Cdc42/PAK complex regulates the microtubule and actin cytoskeletons and cell growth polarization in fission yeast. ^

Evolution of cis-regulatory elements in a repetitive sequence adjacent to a sea urchin aboral ectoderm -specific gene

The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. In this study, critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes were identified and explored. In genomes of species within the Strongylocentrotidae family, multiple copies of a repetitive sequence element termed RSR were present, but RSRs were not detected in genomes of species outside Strongylocentrotidae. RSRs are invariably associated with spec genes, and in Strongylocentrotus purpuratus, the spec2a RSR functioned as a transcriptional enhancer displaying greater activity than RSRs from the spec1 or spec2c paralogs. Single base-pair differences at two cis-regulatory elements within the spec2a RSR greatly increased the binding affinities of four transcription factors: SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which SpCCAAT-binding factor, SpOtx, SpGoosecoid, and SpGATA-E bound were recent evolutionary acquisitions that could act either to activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in the RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. These results indicate that spec genes exhibit a dynamic pattern of cis-regulatory element evolution while stabilizing selection preserves their aboral ectoderm expression domain. ^

Localization of ion-regulatory epithelia in embryos and hatchlings of two cephalopods

The tissue distribution and ontogeny of Na+/K+-ATPase has been examined as an indicator for ion-regulatory epithelia in whole animal sections of embryos and hatchlings of two cephalopod species: the squid Loligo vulgaris and the cuttlefish Sepia officinalis. This is the first report of the immunohistochemical localization of cephalopod Na+/K+-ATPase with the polyclonal antibody alpha (H-300) raised against the human alpha1-subunit of Na+/K+-ATPase. Na+/K+-ATPase immunoreactivity was observed in several tissues (gills, pancreatic appendages, nerves), exclusively located in baso-lateral membranes lining blood sinuses. Furthermore, large single cells in the gill of adult L. vulgaris specimens closely resembled Na+/K+-ATPase-rich cells described in fish. Immunohistochemical observations indicated that the amount and distribution of Na+/K+-ATPase in late cuttlefish embryos was similar to that found in juvenile and adult stages. The ion-regulatory epithelia (e.g., gills, excretory organs) of the squid embryos and paralarvae exhibited less differentiation than adults. Na+/K+-ATPase activities for whole animals were higher in hatchlings of S. officinalis (157.0 ± 32.4 µmol/g FM/h) than in those of L. vulgaris (31.8 ± 3.3 µmol/g FM/h). S. officinalis gills and pancreatic appendages achieved activities of 94.8 ± 18.5 and 421.8 ± 102.3 µmol ATP/g FM/h, respectively. High concentrations of Na+/K+-ATPase in late cephalopod embryos might be important in coping with the challenging abiotic conditions (low pH, high pCO2) that these organisms encounter inside their eggs. Our results also suggest a higher sensitivity of squid vs. cuttlefish embryos to environmental acid-base disturbances.

Impaired fetal T cell development and perinatal lethality in mice lacking the cAMP response element binding protein

CREB, the cAMP response element binding protein, is a key transcriptional regulator of a large number of genes containing a CRE consensus sequence in their upstream regulatory regions. Mice with a hypomorphic allele of CREB that leads to a loss of the CREBα and Δ isoforms and to an overexpression of the CREBβ isoform are viable. Herein we report the generation of CREB null mice, which have all functional isoforms (CREBα, β, and Δ) inactivated. In contrast to the CREBαΔ mice, CREB null mice are smaller than their littermates and die immediately after birth from respiratory distress. In brain, a strong reduction in the corpus callosum and the anterior commissures is observed. Furthermore, CREB null mice have an impaired fetal T cell development of the αβ lineage, which is not affected in CREBαΔ mice on embryonic day 18.5. Overall thymic cellularity in CREB null mice is severely reduced affecting all developmental stages of the αβ T cell lineage. In contrast γδ T cell differentiation is normal in CREB mutant mice.

Cross-lineage expression of Ig-β (B29) in thymocytes: Positive and negative gene regulation to establish T cell identity

Developmental commitment involves activation of lineage-specific genes, stabilization of a lineage-specific gene expression program, and permanent inhibition of inappropriate characteristics. To determine how these processes are coordinated in early T cell development, the expression of T and B lineage-specific genes was assessed in staged subsets of immature thymocytes. T lineage characteristics are acquired sequentially, with germ-line T cell antigen receptor-β transcripts detected very early, followed by CD3ɛ and terminal deoxynucleotidyl transferase, then pTα, and finally RAG1. Only RAG1 expression coincides with commitment. Thus, much T lineage gene expression precedes commitment and does not depend on it. Early in the course of commitment to the T lineage, thymocytes lose the ability to develop into B cells. To understand how this occurs, we also examined expression of well defined B lineage-specific genes. Although λ5 and Ig-α are not expressed, the μ0 and Iμ transcripts from the unrearranged IgH locus are expressed early, in distinct patterns, then repressed just before RAG1 expression. By contrast, RNA encoding the B cell receptor component Ig-β was found to be transcribed in all immature thymocyte subpopulations and throughout most thymocyte differentiation. Ig-β expression is down-regulated only during positive selection of CD4+CD8– cells. Thus several key participants in the B cell developmental program are expressed in non-B lineage-committed cells, and one is maintained even through commitment to an alternative lineage, and repressed only after extensive T lineage differentiation. The results show that transcriptional activation of “lymphocyte-specific” genes can occur in uncommitted precursors, and that T lineage commitment is a composite of distinct positive and negative regulatory events.

Photodynamic therapy results in induction of WAF1/CIP1/P21 leading to cell cycle arrest and apoptosis

Photodynamic therapy (PDT) is a promising new modality that utilizes a combination of a photosensitizing chemical and visible light for the management of a variety of solid malignancies. The mechanism of PDT-mediated cell killing is not well defined. We investigated the involvement of cell cycle regulatory events during silicon phthalocyanine (Pc4)-PDT-mediated apoptosis in human epidermoid carcinoma cells A431. PDT resulted in apoptosis, inhibition of cell growth, and G0-G1 phase arrest of the cell cycle, in a time-dependent fashion. Western blot analysis revealed that PDT results in an induction of the cyclin kinase inhibitor WAF1/CIP1/p21, and a down-regulation of cyclin D1 and cyclin E, and their catalytic subunits cyclin-dependent kinase (cdk) 2 and cdk6. The treatment also resulted in a decrease in kinase activities associated with all the cdks and cyclins examined. PDT also resulted in (i) an increase in the binding of cyclin D1 and cdk6 toward WAF1/CIP1/p21, and (ii) a decrease in the binding of cyclin D1 toward cdk2 and cdk6. The binding of cyclin E and cdk2 toward WAF1/CIP1/p21, and of cyclin E toward cdk2 did not change by the treatment. These data suggest that PDT-mediated induction of WAF1/CIP1/p21 results in an imposition of artificial checkpoint at G1 → S transition thereby resulting in an arrest of cells in G0-G1 phase of the cell cycle through inhibition in the cdk2, cdk6, cyclin D1, and cyclin E. We suggest that this arrest is an irreversible process and the cells, unable to repair the damages, ultimately undergo apoptosis.

MgATP activates the β cell KATP channel by interaction with its SUR1 subunit

ATP-sensitive potassium (KATP) channels in the pancreatic β cell membrane mediate insulin release in response to elevation of plasma glucose levels. They are open at rest but close in response to glucose metabolism, producing a depolarization that stimulates Ca2+ influx and exocytosis. Metabolic regulation of KATP channel activity currently is believed to be mediated by changes in the intracellular concentrations of ATP and MgADP, which inhibit and activate the channel, respectively. The β cell KATP channel is a complex of four Kir6.2 pore-forming subunits and four SUR1 regulatory subunits: Kir6.2 mediates channel inhibition by ATP, whereas the potentiatory action of MgADP involves the nucleotide-binding domains (NBDs) of SUR1. We show here that MgATP (like MgADP) is able to stimulate KATP channel activity, but that this effect normally is masked by the potent inhibitory effect of the nucleotide. Mg2+ caused an apparent reduction in the inhibitory action of ATP on wild-type KATP channels, and MgATP actually activated KATP channels containing a mutation in the Kir6.2 subunit that impairs nucleotide inhibition (R50G). Both of these effects were abolished when mutations were made in the NBDs of SUR1 that are predicted to abolish MgATP binding and/or hydrolysis (D853N, D1505N, K719A, or K1384M). These results suggest that, like MgADP, MgATP stimulates KATP channel activity by interaction with the NBDs of SUR1. Further support for this idea is that the ATP sensitivity of a truncated form of Kir6.2, which shows functional expression in the absence of SUR1, is unaffected by Mg2+.

Activity and nature of p21WAF1 complexes during the cell cycle

Elevated levels of the p21WAF1 (p21) cyclin-dependent kinase inhibitor induce growth arrest. We have characterized a panel of monoclonal antibodies against human p21 in an effort to understand the dynamic regulatory interactions between this and other cellular proteins during the cell cycle. The use of these reagents has allowed us to address several important, yet unresolved, issues concerning the biological activity of p21, including the potential kinase activity of complexes that associate with this cyclin-dependent kinase inhibitor. We have found that the kinase activity of cyclin A/Cdk2 associated with p21 is significantly lower than that of cyclin A/Cdk2 free of p21, suggesting that p21 abolishes its activity in vivo, and the use of multiple antibodies has enabled us to begin the study of the molecular architecture of p21 complexes in vivo. In addition, we found that human fibroblasts released from a quiescent state display abundant amounts of p21 devoid of associated proteins (“free” p21), the levels of which decrease as cells approach S phase. Cyclin A levels increase as the amount of monomeric p21 decreases, resulting in an excess of cyclin A/Cdk2 complexes that are not bound to, or inactivated by, p21. Our data strengthen the notion that the G1-to-S phase transition in human fibroblasts occurs when the concentration of cyclin A/Cdk2 surpasses that of p21.

Cell-cycle arrest and apoptosis hypersusceptibility as a consequence of Lck deficiency in nontransformed T lymphocytes

By using antisense RNA, Lck-deficient transfectants of a T helper 2 (Th2) clone have been derived and shown to have a qualitative defect in the T cell receptor signaling pathway. A striking feature observed only in Lck-deficient T cells was the presence of a constitutively tyrosine-phosphorylated 32-kDa protein. In the present study, we provide evidence that this aberrantly hyperphosphorylated protein is p34cdc2 (cdc2) a key regulator of cell-cycle progression. Lck-deficient transfectants expressed high levels of cdc2 protein and its regulatory units, cyclins A and B. The majority of cdc2, however, was tyrosine-phosphorylated and therefore enzymatically inactive. The transfectants were significantly larger than the parental cells and contained 4N DNA. These results establish that a deficiency in Lck leads to a cell-cycle arrest in G2. Moreover, transfected cells were hypersusceptible to apoptosis when activated through the T cell receptor. Importantly, however, this hypersusceptibility was largely reversed in the presence of T cell growth factors. These findings provide evidence that, in mature T lymphocytes, cell-cycle progression through the G2–M check point requires expression of the Src-family protein tyrosine kinase, Lck. This requirement is Lck-specific; it is observed under conditions in which the closely related Fyn kinase is expressed normally, evincing against a redundancy of function between these two kinases.

Rapid and efficient fusion of phospholipid vesicles by the α-helical core of a SNARE complex in the absence of an N-terminal regulatory domain

A protease-resistant core domain of the neuronal SNARE complex consists of an α-helical bundle similar to the proposed fusogenic core of viral fusion proteins [Skehel, J. J. & Wiley, D. C. (1998) Cell 95, 871–874]. We find that the isolated core of a SNARE complex efficiently fuses artificial bilayers and does so faster than full length SNAREs. Unexpectedly, a dramatic increase in speed results from removal of the N-terminal domain of the t-SNARE syntaxin, which does not affect the rate of assembly of v-t SNARES. In the absence of this negative regulatory domain, the half-time for fusion of an entire population of lipid vesicles by isolated SNARE cores (≈10 min) is compatible with the kinetics of fusion in many cell types.