Computerized polymorphic marker identification: Experimental validation and a predicted human polymorphism catalog

A computational system for the prediction of polymorphic loci directly and efficiently from human genomic sequence was developed and verified. A suite of programs, collectively called pompous (polymorphic marker prediction of ubiquitous simple sequences) detects tandem repeats ranging from dinucleotides up to 250 mers, scores them according to predicted level of polymorphism, and designs appropriate flanking primers for PCR amplification. This approach was validated on an approximately 750-kilobase region of human chromosome 3p21.3, involved in lung and breast carcinoma homozygous deletions. Target DNA from 36 paired B lymphoblastoid and lung cancer lines was amplified and allelotyped for 33 loci predicted by pompous to be variable in repeat size. We found that among those 36 predominately Caucasian individuals 22 of the 33 (67%) predicted loci were polymorphic with an average heterozygosity of 0.42. Allele loss in this region was found in 27/36 (75%) of the tumor lines using these markers. pompous provides the genetic researcher with an additional tool for the rapid and efficient identification of polymorphic markers, and through a World Wide Web site, investigators can use pompous to identify polymorphic markers for their research. A catalog of 13,261 potential polymorphic markers and associated primer sets has been created from the analysis of 141,779,504 base pairs of human genomic sequence in GenBank. This data is available on our Web site (pompous.swmed.edu) and will be updated periodically as GenBank is expanded and algorithm accuracy is improved.

Determination of gene organization in individual haplotypes by analyzing single DNA fragments from single spermatozoa

To determine human Ig heavy chain variable region (VH) gene segment organization on individual homologous chromosomes, an efficient approach has been developed. Single spermatozoa were used as subjects for the study. Upon sperm lysis, VH regions in each sperm were randomly sheared into fragments by the random Brownian force. The fragments were separated from each other by aliquoting the lysate into a certain number of tubes. The gene segments in the VH1 and VH4 families in each tube were identified by denaturing gradient gel electrophoresis after PCR amplification. The polymorphic VH sequences were used to determine the parental origins of the analyzed sperm. VH segment organization in the parental haplotypes was determined by aligning the overlapping fragments from the spermatozoa with the corresponding haplotypes. Based on this comparison between the resulting haplotype maps and the composite map reported previously, the VH region on chromosome 14 could be subdivided into four portions. The numbers and compositions of the VH gene segments differ considerably among the maps in two portions, but are highly conserved in the other two. The data also indicate that the VH region on chromosome 15 may contain a large duplicated block with copy number varying among haplotypes. The approach used in the present study may be used to construct high-resolution haplotype maps without molecular cloning.

Polymorphic simple sequence repeat regions in chloroplast genomes: applications to the population genetics of pines.

Simple sequence repeats (SSRs), consisting of tandemly repeated multiple copies of mono-, di-, tri-, or tetranucleotide motifs, are ubiquitous in eukaryotic genomes and are frequently used as genetic markers, taking advantage of their length polymorphism. We have examined the polymorphism of such sequences in the chloroplast genomes of plants, by using a PCR-based assay. GenBank searches identified the presence of several (dA)n.(dT)n mononucleotide stretches in chloroplast genomes. A chloroplast (cp) SSR was identified in three pine species (Pinus contorta, Pinus sylvestris, and Pinus thunbergii) 312 bp upstream of the psbA gene. DNA amplification of this repeated region from 11 pine species identified nine length variants. The polymorphic amplified fragments were isolated and the DNA sequence was determined, confirming that the length polymorphism was caused by variation in the length of the repeated region. In the pines, the chloroplast genome is transmitted through pollen and this PCR assay may be used to monitor gene flow in this genus. Analysis of 305 individuals from seven populations of Pinus leucodermis Ant. revealed the presence of four variants with intrapopulational diversities ranging from 0.000 to 0.629 and an average of 0.320. Restriction fragment length polymorphism analysis of cpDNA on the same populations previously failed to detect any variation. Population subdivision based on cpSSR was higher (Gst = 0.22, where Gst is coefficient of gene differentiation) than that revealed in a previous isozyme study (Gst = 0.05). We anticipate that SSR loci within the chloroplast genome should provide a highly informative assay for the analysis of the genetic structure of plant populations.

p53-dependent growth arrest of REF52 cells containing newly amplified DNA.

The rat cell line REF52 is not permissive for gene amplification. Simian virus 40 tumor (T) antigen converts these cells to a permissive state, as do dominant negative mutants of p53, suggesting that the effect of T antigen is due mainly to its ability to bind to p53. To manipulate permissivity, we introduced a temperature-sensitive mutant of T antigen (tsA58) into REF52 cells and selected for resistance to N-(phosphonacetyl)-L-aspartate (PALA). Most freshly isolated PALA-resistant colonies, each of approximately 200 cells, selected at a permissive temperature, arrested when shifted to a nonpermissive temperature. Growth arrest was stable, with no evidence of apoptosis, as long as T antigen was absent but was reversed when T antigen was restored. In contrast, PALA-resistant clones grown to approximately 10(7) cells at a permissive temperature did not arrest when shifted to a nonpermissive temperature. All PALA-resistant clones examined had amplified carbamoyl-phosphate synthetase-aspartate transcarbamoylase-dihydroorotase (CAD) genes, present in structures consistent with a mechanism involving bridge-breakage-fusion (BBF) cycles. We propose that p53-mediated growth arrest operates only early during the complex process of gene amplification, when newly formed PALA-resistant cells contain broken DNA, generated in BBF cycles. During propagation under permissive conditions, the broken DNA ends are healed, and, even though the p53-mediated pathway is still intact at a nonpermissive temperature and the cells contain amplified DNA, they are not arrested in the absence of broken DNA. The data support the hypothesis that BBF cycles are an important mechanism of amplification and that the broken DNA generated in each cycle is a key signal that regulates permissivity for gene amplification.

Use of a novel DNA melting profile assay for the identification of PCR-amplified genomic sequences encoding for variant-specific surface proteins from the clonal GS/M-83-H7 line of Giardia lamblia.

During infections, Giardia lamblia undergoes a continuous change of its major surface antigens, the variant-specific surface proteins (VSPs). Many studies on antigenic variation have been performed using G. lamblia clone GS/M-83-H7, which expresses surface antigen VSP H7. The present study was focused on the identification and characterization of vsp gene sequences within the genome of the clonal G. lamblia GS/M-83-H7 line. For this purpose, we applied a PCR which specifically amplified truncated sequences from the 3'-terminal region of the vsp genes. Upon cloning, most of the vsp gene amplification products were shown to be approximately identical in size and thus could not be distinguished from each other by conventional gel electrophoresis. In order to pre-estimate the sequence complexity within the large panel of vsp clones isolated, we elaborated a novel concept which facilitated our large-scale genetic screening approach: PCR products from cloned DNA molecules were generated and then subjected to a DNA melting profile assay based on the use of the LightCycler Instrument. This high-throughput assay system proved to be well suited to monitor sequence differences between the amplification products from closely related vsp genes and thus could be used for the primary, sequence-related discrimination of the corresponding clones. After testing 50 candidates, vsp clones could be divided into five groups, each characterized by an individual DNA melting profile of the corresponding amplification products. Sequence analysis of some of these 50 candidates confirmed data from the aforementioned assay in that clones were demonstrated to be identical within, but different between, the distinct groups. The nucleotide and deduced amino acid sequences of five representative vsp clones showed high similarities both among each other and also with the corresponding gene segment of the variant-specific surface antigen (VSP H7) expressed by the original GS/M-83-H7 variant type. Furthermore, three of the genomic vsp sequences turned out to be identical to vsp sequences that represented previously characterized transcription products from in vivo- or in vitro-switched GS/M-83-H7 trophozoites. In conclusion, the DNA melting profile assay seems to be a versatile tool for the PCR-based genotyping of moderately or highly diversified sequence orthologues.

Dna Extraction From Filter-paper Spots Of Vaginal Samples Collected After Sexual Violence.

To detect the presence of male DNA in vaginal samples collected from survivors of sexual violence and stored on filter paper. A pilot study was conducted to evaluate 10 vaginal samples spotted on sterile filter paper: 6 collected at random in April 2009 and 4 in October 2010. Time between sexual assault and sample collection was 4-48hours. After drying at room temperature, the samples were placed in a sterile envelope and stored for 2-3years until processing. DNA extraction was confirmed by polymerase chain reaction for human β-globin, and the presence of prostate-specific antigen (PSA) was quantified. The presence of the Y chromosome was detected using primers for sequences in the TSPY (Y7/Y8 and DYS14) and SRY genes. β-Globin was detected in all 10 samples, while 2 samples were positive for PSA. Half of the samples amplified the Y7/Y8 and DYS14 sequences of the TSPY gene and 30% amplified the SRY gene sequence of the Y chromosome. Four male samples and 1 female sample served as controls. Filter-paper spots stored for periods of up to 3years proved adequate for preserving genetic material from vaginal samples collected following sexual violence.

Protective effects of mate tea (Ilex paraguariensis) on H2O2-induced DNA damage and DNA repair in mice

Yerba mate (Ilex paraguariensis) is rich in several bioactive compounds that can act as free radical scavengers. Since oxidative DNA damage is involved in various pathological states such as cancer, the aim of this study was to evaluate the antioxidant activity of mate tea as well as the ability to influence DNA repair in male Swiss mice. Forty animals were randomly assigned to four groups. The animals received three different doses of mate tea aqueous extract, 0.5, 1.0 or 2.0 g/kg, for 60 days. After intervention, the liver, kidney and bladder cells were isolated and the DNA damage induced by H2O2 was investigated by the comet assay. The DNA repair process was also investigated for its potential to protect the cells from damage by the same methodology. The data presented here show that mate tea is not genotoxic in liver, kidney and bladder cells. The regular ingestion of mate tea increased the resistance of DNA to H2O2-induced DNA strand breaks and improved the DNA repair after H2O2 challenge in liver cells, irrespective of the dose ingested. These results suggest that mate tea could protect against DNA damage and enhance the DNA repair activity. Protection may be afforded by the antioxidant activity of the mate tea's bioactive compounds

Detection of the TLR4 1196C > T Polymorphism by Mismatched-Polymerase Chain Reaction Using Plasmid DNA as Internal Control in Restriction Fragment Length Polymorphism Assays

Background: Restriction fragment length polymorphism (RFLP) is a common molecular assay used for genotyping, and it requires validated quality control procedures to prevent mistyping caused by impaired endonuclease activity. We have evaluated the usefulness of a plasmid-based internal control in RFLP assays. Results: Blood samples were collected from 102 individuals with acute myocardial infarction (AMI) and 108 non-AMI individuals (controls) for DNA extraction and laboratory analyses. The 1196C> T polymorphism in the toll-like receptor 4 (TLR4) gene was amplified by mismatched-polymerase chain reaction (PCR). Amplicons and pBluescript II SK-plasmid were simultaneously digested with endonuclease HincII. Fragments were separated on 2% agarose gels. Plasmid was completely digested using up to 55.2 nmL/L DNA solutions and 1 mu L PCR product. Nevertheless, plasmid DNA with 41.4 nM or higher concentrations was incompletely digested in the presence of 7 mL PCR product. In standardized conditions, TLR4 1196C> T variant was accurately genotyped. TLR4 1196T allele frequency was similar between AMI (3.1%) and controls (2.0%, p = 0.948). TLR4 SNP was not associated with AMI in this sample population. In conclusion, the plasmid-based control is a useful approach to prevent mistyping in RFLP assays, and it is validate for genetic association studies such as TLR4 1196C> T.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum)

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

SOX2 is an amplified lineage-survival oncogene in lung and esophageal squamous cell carcinomas

Lineage-survival oncogenes are activated by somatic DNA alterations in cancers arising from the cell lineages in which these genes play a role in normal development(1,2). Here we show that a peak of genomic amplification on chromosome 3q26.33 found in squamous cell carcinomas (SCCs) of the lung and esophagus contains the transcription factor gene SOX2, which is mutated in hereditary human esophageal malformations(3), is necessary for normal esophageal squamous development(4), promotes differentiation and proliferation of basal tracheal cells(5) and cooperates in induction of pluripotent stem cells(6-8). SOX2 expression is required for proliferation and anchorage-independent growth of lung and esophageal cell lines, as shown by RNA interference experiments. Furthermore, ectopic expression of SOX2 here cooperated with FOXE1 or FGFR2 to transform immortalized tracheobronchial epithelial cells. SOX2-driven tumors show expression of markers of both squamous differentiation and pluripotency. These characteristics identify SOX2 as a lineage-survival oncogene in lung and esophageal SCC.

Matrix metalloproteinase-2 polymorphism is associated with prognosis in prostate cancer

Objective: Prostate cancer (PCa) is the most frequent tumor in males in Brazil. Single nucleotide polymorphisms (SNP) have been demonstrated in the promoter region of matrix metalloproteinases (MMPs) genes and have been associated with development and progression of some cancers. In this study, our aim was to investigate a possible relation between polymorphism of the promoter region of the MMP2 gene and classical prognostic parameters in prostate cancer. Materials and methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by real-time polymerase chain reaction, using fluorescent probes (TaqMan). Results: In patients with tumors of a higher stage (pT3), a polymorphic allele in the MMP2 gene was more frequent (P = 0.026) than in patients with lower tumor stage. A polymorphic allele in the MMP2 gene was more frequent in Gleason >= 7 than in Gleason <= 6 (P = 0.042). Conclusions: We conclude that MMP2 polymorphism can be used together with pathological stage and Gleason score to identify patients with worse prognosis. Our results illustrate the potential use of MMP2 SNP as a molecular marker for prostate cancer. (C) 2010 Elsevier Inc. All rights reserved.

Genetic Polymorphisms of Matrix Metalloproteinases: Susceptibility and Prognostic Implications for Prostate Cancer

Purpose: Prostate cancer is the most common tumor in males in Brazil. Single nucleotide polymorphisms have been demonstrated to exist in the promoter regions of matrix metalloproteinase genes and they are associated with the development and progression of some cancers. We investigated the correlation between MMP1, 2, 7 and 9 polymorphisms with susceptibility to prostate cancer, and classic prognostic parameters of prostate cancer. Materials and Methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by realtime polymerase chain reaction using TaqMan (R) fluorescent probes. Results: For the MMP1 gene the polymorphic allele was more common in the control group than in the prostate cancer group (p <0.001). For the MMP9 gene the incidence of the polymorphic homozygote genotype was higher in the prostate cancer group (p <0.001). For higher stage tumors (pT3) a polymorphic allele in the MMP2 gene was more common (p = 0.026). When considering Gleason score, the polymorphic homozygote genotype of MMP9 was more common in Gleason 6 or less tumors (p = 0.003), while a polymorphic allele in the MMP2 gene was more common in Gleason 7 or greater tumors (p = 0.042). Conclusions: MMP1 and MMP2 may protect against prostate cancer development and MMP9 may be related to higher risk. In contrast, MMP9 polymorphism was associated with a lower Gleason score and MMP2 polymorphism was associated with nonorgan confined disease.

Indirect immune detection of ecdysone receptor (EcR) during the formation of DNA puffs in Bradysia hygida (Diptera, Sciaridae)

Gene amplification occurs in Bradysia hygida salivary glands, at the end of the fourth larval instar. The hormone 20-hydroxyecdysone (20E) triggers this process, which results in DNA puff formation. Amplified genes are activated in two distinct groups. The activity of the first group is dependent on high levels of 20E, while the second group needs low hormone levels. Consequently, the salivary glands of B. hygida constitute an interesting biological model to study how 20E, and its receptors, affect gene amplification and activity. We produced polyclonal antibodies against B. hygida EcR (BhEcR). In western blots a polypeptide of about 66 kDa was detected in salivary gland extracts. The antibodies were also used for indirect immune-localization of BhEcR in polytene chromosomes. RNA-polymerase II was also immune-detected. We did not detect the receptor in chromosome C where the first and second groups of DNA puffs form during DNA puff anlage formation, but it was present during puff expansion. During the active phase of both groups of DNA puffs, RNA polymerase II co-localized with BhEcR. After puff regression, these antigens were not detected. Apparently, EcR plays a direct role in the transcription of amplified genes, but its role in gene amplification remains enigmatic.

Efficiency of the DNA repair and polymorphisms of the XRCC1, XRCC3 and XRCC4 DNA repair genes in systemic lupus erythematosus

Impaired DNA repair efficiency in systematic lupus erythematosus (SLE) patients has been reported ill some studies, mainly regarding the repair of oxidative damage, but little is known about repair kinetics towards primarily single-stranded DNA breaks. In the present study, we aimed to investigate: (a) the efficiency of SLE peripheral blood leucocytes in repairing DNA damage induced by ionizing radiation and (b) the association of DNA repair gene (XRCC1 Arg399Gln, XRCC3 Thr241Met and XRCC4 Ile401Thr) polymorphisms in SLE patients, considering the whole group, or stratified sub-groups according to clinical and laboratory features. A total of 163 SLE patients and 125 healthy control were studied. The kinetics of DNA strand break repair was evaluated by the comet assay, and genotyping for DNA repair genes was performed by PCR-RFLP. Compared with controls. SLE leucocytes exhibited decreased efficiency of DNA repair evaluated at 30 min following irradiation. A significant association with DNA repair gene polymorphisms was not observed for the whole group of SLE patients; however, the XRCC1Arg399Gln polymorphism was associated with the presence of anti-dsDNA antibody. The concomitance of two DNA repair polymorphic sites was associated with the presence of neuropsychiatric manifestations and antiphospholipid antibody syndrome. Taken together, these results indicated that SLE leucocytes repair less efficiently the radiation-induced DNA damage, and DNA repair polymorphic sites may predispose to the development of particular clinical and laboratory features. Lupus (2008) 17, 988-995.