989 resultados para Polytene chromosomes
Resumo:
Two biotypes (A and B) of Colletotrichum gloeosporioides infect the tropical legumes Stylosanthes spp. in Australia. These biotypes are asexual and vegetatively incompatible. However, field isolates of biotype B carrying a supernumerary 2-Mb chromosome, thought to originate from biotype A, have been reported previously. We tested the hypothesis that the 2-Mb chromosome could be transferred from biotype A to biotype B under laboratory conditions. Selectable marker genes conferring resistance to hygromycin and phleomycin were introduced into isolates of biotypes A and B, respectively. A transformant of biotype A, with the hygromycin resistance gene integrated on the 2-Mb chromosome, was cocultivated with phleomycin-resistant transformants of biotype B. Double antibiotic-resistant colonies were obtained from conidia of these mixed cultures at a frequency of approximately 10(-7). Molecular analysis using RFLPs, RAPDs, and electrophoretic karyotypes showed that these colonies contained the 2-Mb chromosome in a biotype B genetic background. In contrast, no double antibiotic colonies developed from conidia obtained from mixed cultures of phleomycin-resistant transformants of biotype B with biotype A transformants carrying the hygromycin resistance gene integrated in chromosomes >2 Mb in size. The results demonstrated that the 2-Mb chromosome was selectively transferred from biotype A to biotype B. The horizontal transfer of specific chromosomes across vegetative incompatibility barriers may explain the origin of supernumerary chromosomes in fungi.
Resumo:
The equal sex ratios found in many species with heterogametic sex determination may be a consequence of selection for equality or the result of the Mendelian segregation of the two sex chromosomes. A lack of genetic variation in sex ratio in species with heterogamety has been the major obstacle in distinguishing between these two hypotheses. We overcome this obstacle by generating hybrids between two species of Drosophila. The resulting hybrid lines had biased sex ratios, allowing us to observe the evolution of sex ratio in replicate populations. Sex ratio converged towards 1:1 after 16 generations of natural selection. These changes in sex ratio were not due to differences in viability between the sexes and the loci underlying the variation in sex ratio were not sex-linked. Equal sex ratios may therefore be the result of natural selection as Fisher predicted.
Resumo:
Recent reports have shown neurodegenerative disorders to be associated with abnormal expansions of a CAG trinucleotide repeat allele at various autosomal loci. While normal chromosomes have 14 to 44 repeats, disease chromosomes may have 60 to 84 repeats. The number of CAG repeats on mutant chromosomes correlates with increasing severity of disease or decreasing age at onset of symptoms. Since we are interested in identifying the many quantitative trait loci (QTL) influencing brain functioning, we examined the possibility that the number of CAG repeats in the normal size range at these loci are relevant to "normal" neural functioning. We have used 150 pairs of adolescent (aged 16 years) twins and their parents to examine allele size at the MJD, SCA1, and DRPLA loci in heterozygous normal individuals. These are part of a large ongoing project using cognitive and physiological measures to investigate the genetie influences on cognition, and an extensive protocol of tests is employed to assess some of the key components of intellectual functioning. This study selected to examine full-scale psychometric IQ (FSIQ) and a measure of information processing (choice reaction time) and working memory (slow wave amplitude). CAG repeat size was determined on an ABI Genescan system following multiplex PCR amplification. Quantitative genetic analyses were performed to determine QTL effects of MJD, SCA1, and DRPLA on cognitive functioning. Analyses are in progress and will be discussed.
Resumo:
Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.
Resumo:
Although several genes for idiopathic epilepsies from families with simple Mendelian inheritance have been found, genes for the common idiopathic generalized epilepsies, where inheritance is complex, presently are elusive. We studied a large family with epilepsy where the two main phenotypes were childhood absence epilepsy (CAE) and febrile seizures (FS), which offered a special opportunity to identify epilepsy genes. A total of 35 family members had seizures over four generations. The phenotypes comprised typical CAE (eight individuals); FS alone (15), febrile seizures plus (FS+) (three); myoclonic astatic epilepsy (two); generalized epilepsy with tonic-clonic seizures alone (one); partial epilepsy (one); and unclassified epilepsy despite evaluation (two). In three remaining individuals, no information was available. FS were inherited in an autosomal dominant fashion with 75% penetrance. The inheritance of CAE in this family was not simple Mendelian, but suggestive of complex inheritance with the involvement of at least two genes. A GABA(A) receptor gamma2 subunit gene mutation on chromosome 5 segregated with FS, FS+ and CAE, and also occurred in individuals with the other phenotypes. The clinical and molecular data suggest that the GABA(A) receptor subunit mutation alone can account for the FS phenotype. An interaction of this gene with another gene or genes is required for the CAE phenotype in this family. Linkage analysis for a putative second gene contributing to the CAE phenotype suggested possible loci on chromosomes 10, 13, 14 and 15. Examination of these loci in other absence pedigrees is warranted.
Resumo:
In this paper, genetic algorithm (GA) is applied to the optimum design of reinforced concrete liquid retaining structures, which comprise three discrete design variables, including slab thickness, reinforcement diameter and reinforcement spacing. GA, being a search technique based on the mechanics of natural genetics, couples a Darwinian survival-of-the-fittest principle with a random yet structured information exchange amongst a population of artificial chromosomes. As a first step, a penalty-based strategy is entailed to transform the constrained design problem into an unconstrained problem, which is appropriate for GA application. A numerical example is then used to demonstrate strength and capability of the GA in this domain problem. It is shown that, only after the exploration of a minute portion of the search space, near-optimal solutions are obtained at an extremely converging speed. The method can be extended to application of even more complex optimization problems in other domains.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
We aimed to study patterns of variation and factors influencing the evolutionary dynamics of a satellite DNA, pBuM, in all seven Drosophila species from the buzzatii cluster (repleta group). We analyzed 117 alpha pBuM-1 (monomer length 190 bp) and 119 composite alpha/beta (370 bp) pBuM-2 repeats and determined the chromosome location and long-range organization on DNA fibers of major sequence variants. Such combined methodologies in the study of satDNAs have been used in very few organisms. In most species, concerted evolution is linked to high copy number of pBuM repeats. Species presenting low-abundance and scattered distributed pBuM repeats did not undergo concerted evolution and maintained part of the ancestral inter-repeat variability. The alpha and alpha/beta repeats colocalized in heterochromatic regions and were distributed on multiple chromosomes, with notable differences between species. High-resolution FISH revealed array sizes of a few kilobases to over 0.7 Mb and mutual arrangements of alpha and alpha/beta repeats along the same DNA fibers, but with considerable changes in the amount of each variant across species. From sequence, chromosomal and phylogenetic data, we could infer that homogenization and amplification events involved both new and ancestral pBuM variants. Altogether, the data on the structure and organization of the pBuM satDNA give insights into genome evolution including mechanisms that contribute to concerted evolution and diversification.
Resumo:
Background: The androgen receptor gene is located on the X chromosome with a polymorphic tract of CAG repeats that is inversely correlated to the receptor`s transactivation activity. A short CAG tract is associated with hyperandrogenic disorders. In women, one of the X chromosomes is inactivated and the X chromosome inactivation (XCI) pattern varies among tissues. Previous studies of hyperandrogenic disorders only evaluated XCI in leukocytes. Objective: To evaluate whether the XCI pattern in leukocytes could be extrapolated to those in hair bulbs. Material: A total of 58 healthy women were used for this study. DNA was extracted from leukocytes (n = 58 women) and pubic (n = 53 women) and scalp hair (n = 21 women). Methods: Hpa II digested and undigested DNA samples underwent fluorescence PCR GeneScan (R) analysis. Results: A significant and positive correlation of XCI was found between leukocytes and hair bulbs. However, individual comparisons showed that 13 and 19% of the women presented a different leukocyte XCI pattern in pubic hair and similar in leukocytes and hair bulbs of normal women indicating that leukocyte DNA is useful for XCI analysis. However, the XCI pattern could vary among tissues from the same subject, indicating that care should be taken when extrapolating individual leukocyte XCI patterns to other tissue. Copyright (C) 2010 S. Karger AG, Basel
Resumo:
L-2-hydroxyglutaric aciduria (L-2-HGA, MIM 236792) is a neurometabolic disorder caused by the toxic accumulation of high concentration of L-2-hydroxyglutaric acid in plasma and cerebrospinal fluid. Distinct mutations on the L2HGDH gene have been associated with the clinical and biochemical phenotype. Here we present three novel mutations (Gln197X, Gly211Val and c.540+1 G>A), which increase the present deleterious collection of L2HGDH gene up to 35 mutations that we have compiled in this study. In addition, we used the haplotypic information based on polymorphic markers to demonstrate the common origin of Gly57Arg harboring chromosomes. Journal of Human Genetics (2010) 55, 55-58; doi: 10.1038/jhg.2009.110; published online 13 November 2009
Resumo:
The term disorders of sex development (DSD) includes congenital conditions in which development of chromosomal, gonadal or anatomical sex is atypical. Mutations in genes present in X, Y or autosomal chromosomes can cause abnormalities of testis determination or disorders of sex differentiation leading to 46,XY DSD. Detailed clinical phenotypes allow the identification of new factors that can alter the expression or function of mutated proteins helping to understand new undisclosed biochemical pathways. In this review we present an update on 46,XY DSD aetiology, diagnosis and treatment based on extensive review of the literature and our three decades of experience with these patients.
Resumo:
Lentil is a self-pollinating diploid (2n = 14 chromosomes) annual cool season legume crop that is produced throughout the world and is highly valued as a high protein food. Several abiotic stresses are important to lentil yields world wide and include drought, heat, salt susceptibility and iron deficiency. The biotic stresses are numerous and include: susceptibility to Ascochyta blight, caused by Ascochyta lentis; Anthracnose, caused by Colletotrichum truncatum; Fusarium wilt, caused by Fusarium oxysporum; Sclerotinia white mold, caused by Sclerotinia sclerotiorum; rust, caused by Uromyces fabae; and numerous aphid transmitted viruses. Lentil is also highly susceptible to several species of Orabanche prevalent in the Mediterranean region, for which there does not appear to be much resistance in the germplasm. Plant breeders and geneticists have addressed these stresses by identifying resistant/tolerant germplasm, determining the genetics involved and the genetic map positions of the resistant genes. To this end progress has been made in mapping the lentil genome and several genetic maps are available that eventually will lead to the development of a consensus map for lentil. Marker density has been limited in the published genetic maps and there is a distinct lack of co-dominant markers that would facilitate comparisons of the available genetic maps and efficient identification of markers closely linked to genes of interest. Molecular breeding of lentil for disease resistance genes using marker assisted selection, particularly for resistance to Ascochyta blight and Anthracnose, is underway in Australia and Canada and promising results have been obtained. Comparative genomics and synteny analyses with closely related legumes promises to further advance the knowledge of the lentil genome and provide lentil breeders with additional genes and selectable markers for use in marker assisted selection. Genomic tools such as macro and micro arrays, reverse genetics and genetic transformation are emerging technologies that may eventually be available for use in lentil crop improvement.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Background/Aims: Approximately four million Africans were taken as slaves to Brazil, where they interbred extensively with Amerindians and Europeans. We have previously shown that while most White Brazilians carry Y chromosomes of European origin, they display high proportions of African and Amerindian mtDNA lineages, because of sex-biased genetic admixture. Methods: We studied the Y chromosome and mtDNA haplogroup structure of 120 Black males from Sao Paulo, Brazil. Results: Only 48% of the Y chromosomes, but 85% of the mtDNA haplogroups were characteristic of sub-Saharan Africa, confirming our previous observation of sexually biased mating. We mined literature data for mtDNA and Y chromosome haplogroup frequencies for African native populations from regions involved in Atlantic Slave Trade. Principal Components Analysis and Bayesian analysis of population structure revealed no genetic differentiation of Y chromosome marker frequencies between the African regions. However, mtDNA examination unraveled considerable genetic structure, with three clusters at Central-West Africa, West Africa and Southeast Africa. A hypothesis is proposed to explain this structure. Conclusion: Using these mtDNA data we could obtain for the first time an estimate of the relative ancestral contribution of Central-West (0.445), West (0.431) and Southeast Africa (0.123) to African Brazilians from Sao Paulo. These estimates are consistent with historical information. Copyright (c) 2008 S. Karger AG, Basel.
Resumo:
Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.