925 resultados para PCR
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fifteen cases of viral meningoencephalitis in Colombian cattle were tested by nested PCR analysis for the detection of bovine herpesvirus 5 (BoHV-5). All fatal cases had shown severe neurological signs and had occurred following natural outbreaks of the disease. The neurological infection was histologically characterized by mild to moderate inflammatory changes in the brain and cerebellum, including meningitis, mononuclear perivascular cuffing, gliosis, haemorrhage, and the presence of Gitter cells (macrophages) accompanying large areas of malacia. No intranuclear inclusion bodies were seen in any of the cases. Results from BoHV-5 molecular extraction analyses showed there were five positive cases thus confirming the presence of the virus in Colombia.
Resumo:
O objetivo deste estudo foi aperfeiçoar um ensaio de PCR que amplificasse um fragmento de 843 pares de bases do gene p28 da Ehrlichia canis e compará-lo com outros dois métodos de PCR utilizados para amplificar partes do gene 16S rRNA e dsb do gênero Ehrlichia. Amostras sanguíneas foram colhidas de cães com diagnóstico clínico de erliquiose. A amplificação do gene p28 pela PCR produziu um fragmento de 843pb e esse ensaio permitiu a detecção do DNA de um parasita dentre 1 bilhão de células. Todas as amostras positivas detectadas pela PCR baseada no gene p28 foram também positivas pela nested PCR para detecção do gene 16S rRNA e também pela PCR dsb. Dentre as amostras negativas para a PCR p28, 55,3% foram co-negativas, mas 27,6% foram positivas pela PCR baseada nos genes 16S rRNA e dsb. A PCR p28 parece ser um teste útil para detecção molecular de E. canis, entretanto otimizações na sensibilidade nesta PCR são necessárias, para que esta técnica se torne uma importante alternativa no diagnóstico da erliquiose canina.
A nested-PCR assay for detection of Xylella fastidiosa in citrus plants and sharpshooter leafhoppers
Resumo:
Aims: Detection of Xylella fastidiosa in citrus plants and insect vectors.Methods and Results: Chelex 100 resin matrix was successfully standardized allowing a fast DNA extraction of X. fastidiosa. An amplicon of 500 bp was observed in samples of citrus leaf and citrus xylem extract, with and without symptoms of citrus variegated chlorosis, using PCR with a specific primer set indicating the presence of X. fastidiosa. The addition of insoluble acid-washed polyvinylpyrrolidone (PVPP) prior to DNA extraction of insect samples using Chelex 100 resin together with nested-PCR permitted the detection of X. fastidiosa within sharpshooter heads with great sensitivity. It was possible to detect up to two bacteria per reaction. From 250 sharpshooter samples comprising four species (Dilobopterus costalimai, Oncometopia facialis, Bucephalogonia xanthopis and Acrogonia sp.), 87 individuals showed positive results for X. fastidiosa in a nested-PCR assay.Conclusions: the use of Chelex 100 resin allowed a fast and efficient DNA extraction to be used in the detection of X. fastidiosa in citrus plants and insect vectors by PCR and nested-PCR assays, respectively.Significance and Impact of the study: the employment of efficient and sensitive methods to detect X. fastidiosa in citrus plants and insect vectors will greatly assist epidemiological studies.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
It proposes a established computational solution in the development of a software to construct species-specific primers, used to improve the diagnosis of virus of plant for PCR. Primers are indispensable to PCR reaction, besides providing the specificity of the diagnosis. Primer is a synthetic, short, single stranded piece of DNA, used as a starter in PCR technique. It flanks the sequence desired to amplify. Species-specific primers indicate the well known region of beginning and ending where the polymerase enzyme is going to amplify on a certain species, i.e. it is specific for only a species. Thus, the main objective of this work is to automatize the process of choice of primers, optimizing the specificity of chosen primers by the traditional method
Resumo:
Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Genomic DNAs isolated from strains of Xylella fastidiosa that caused citrus variegated chlorosis, coffee leaf scorch, Pierce's Disease of grapevine, and plum leaf scorch were analyzed by arbitrarily primed polymerase chain reaction. Purified DNA was amplified under nonstringent conditions with single primers 21 nucleotides (nt) long. Thirty-nine amplification products were observed that were useful to distinguish among the strains and to derive a similarity matrix and construct a phenogram showing possible relationships among the strains. Strains isolated from diseased coffee and citrus in Brazil were closely related to each other (coefficient of similarity of 0.872), but only distantly related to a strain isolated from diseased grapevine in the USA (coefficient of similarity of 0.650). Strains of Xylella fastidiosa isolated from diseased plums in the USA and Brazil clustered with strains from different hosts isolated from their respective countries of origin. Thus, there may be two quite dissimilar clusters of strains of Xylella fastidiosa, one in North America and the other in South America. Each cluster contains strains that can cause disease in plum. The methods described provide a convenient and rapid method to distinguish between strains of Xylella fastidiosa that cause diseases of coffee and citrus in the same region of Brazil. This has not been possible previously. This will potentially enable the two strains to be distinguished in alternate hosts or in insect vectors.
Resumo:
The taxonomy of the N(2)-fixing bacteria belonging to the genus Bradyrhizobium is still poorly refined, mainly due to conflicting results obtained by the analysis of the phenotypic and genotypic properties. This paper presents an application of a method aiming at the identification of possible new clusters within a Brazilian collection of 119 Bradryrhizobium strains showing phenotypic characteristics of B. japonicum and B. elkanii. The stability was studied as a function of the number of restriction enzymes used in the RFLP-PCR analysis of three ribosomal regions with three restriction enzymes per region. The method proposed here uses Clustering algorithms with distances calculated by average-linkage clustering. Introducing perturbations using sub-sampling techniques makes the stability analysis. The method showed efficacy in the grouping of the species B. japonicum and B. elkanii. Furthermore, two new clusters were clearly defined, indicating possible new species, and sub-clusters within each detected cluster. (C) 2008 Elsevier B.V. All rights reserved.
Resumo:
Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card) e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina), para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR). Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad); Insta Gene® (BioRad) e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb), Factor V Leiden (220 pb) e Abelson (106 pb). de acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.
Resumo:
Objetivo: Simplificar o cálculo do índice prognóstico inflamatório nutricional (IPIN) empregando número menor de variáveis com conseqüente redução do custo da análise. Materiais e métodos: Foram estudados 54 pacientes e 12 indivíduos-controle com 48 ± 20 (média ± dp) anos de idade. As principais patologias dos pacientes eram: doença arterial periférica (22), pênfigo foliáceo (7), doença inflamatória intestinal (7), trauma (6) e pós-operatório de ortognatia (3). Foram obtidas amostras de sangue periférico, colhidas em jejum para dosagens de proteínas positivas (+) e negativas (-) de fase aguda (PFA) pelo método nefelométrico. Proteína C reativa (PCR), alfa-1-glicoproteína-ácida (alfa-1-GA), alfa-1-antitripsina (alfa-1-AT) e ceruloplasmina (CER) foram as PFA+ e albumina (Alb), transtiretina (TTR), transferrina (TF) e proteína ligadora do retinol (RBP) foram as representantes das PFA-. Esses valores foram analisados quanto à associação de correlação isolada ou associadamente na fórmula do índice prognóstico inflamatório e nutricional (IPIN = PCR + alfa-1-GA / Alb + TTR). de acordo com o índice prognóstico inflamatório e nutricional, os pacientes foram classificados em grupo-controle (G1); pacientes sem infecção/inflamação (IPIN < 1, G2) ou com risco de inflamação/infecção (IPIN > 1, G3). em seguida os pacientes do G3 foram subdivididos em baixo risco (G3A, n = 16); médio risco ( G3B, n = 10); alto risco (G3C, n = 6) e com risco de morte (G3D, n = 11). Os resultados foram correlacionados entre si (teste de Spearman) ou submetidos às comparações entre grupos (teste de Kruskall-Wallis). Resultados: Houve relação significativa entre as variáveis PCR ´ alfa-1-GA (r = 0,49), Alb ´ TTR (r = 0,60), Alb ´ RBP (r = 0,58), Alb ´ TF (r = 0,39), TTR ´ RBP (r = 0,56) e TTR´ TF (r = 0,43) e as melhores relações encontradas entre PFA+ e PFA- foram: PCR ´ Alb (r = - 0,71), PCR ´ TTR (r = - 0,54), PCR ´ TF (r = - 0,39) e alfa-1-GA ´ Alb (r = - 0,35). Os valores do IPIN mostraram a diferenciação G3 > (G1 = G2) e G3 > G3A. Entre todas as proteínas dosadas apenas PCR, Alb e TTR discriminaram os grupos: sendo G3 > (G1= G2) para PCR e G3< (G1= G2) para Alb e TTR. Apenas PCR, TTR e TF discriminaram a morbimortalidade com G3D > G3A (para PCR) e G3D < G3A (para TTR e TF). PCR/Alb e IPIN apresentaram concordância de valores para os riscos de complicações. Conclusão: Assim, conclui-se pela possibilidade de substituição do IPIN pela relação PCR/albumina, mais simples e de menor custo, mantendo-se o mesmo poder e sensibilidade para diagnóstico dos graus de risco de complicações.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)