834 resultados para Metodologia projetual
Resumo:
On this research we investigated how new technologies can help the process of design and manufacturing of furniture in such small manufacturers in Rio Grande do Norte state. Google SketchUp, a 3D software tool, was developed in such a way that its internal structures are opened and can be accessed using SketchUp s API for Ruby and programs written in Ruby language (plugins). Using the concepts of the so-called Group Technology and the flexibility that enables adding new functionalities to this software, it was created a Methodology for Modeling of Furniture, a Coding System and a plugin for Google s tool in order to implement the Methodology developed. As resulted, the following facilities are available: the user may create and reuse the library s models over-and-over; reports of the materials manufacturing process costs are provided and, finally, detailed drawings, getting a better integration between the furniture design and manufacturing process
Resumo:
Improving the adherence between oilwell metallic casing and cement sheath potentially decrease the number of corrective actions present/y necessary for Northeastern wells submitted to steam injection. In addition to the direct costs involved in the corrective operations, the economic impact of the failure of the primary cementing aIso includes the loss in the production of the well. The adherence between casing and cement is current/y evaluated by a simple shear tests non standardized by the American Petroleum Institute (API). Therefore, the objective of the present is to propose and evaluate a standardized method to assess the adherence of oilwell metallic casing to cement sheath. To that end, a section of a cemented oilwell was simulated and used to test the effect of different parameters on the shear stress of the system. Surface roughness and different cement compositions submitted or not to thermal cycling were evaluated. The results revealed that the test geometry and parameters proposed yielded different values for the shear stress of the system, corresponding to different adherent conditions between metallic casing and cement sheath
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The use of tetrazolium testing is recognized in the soybean seed quality control due to the large amount of data which it provides. Although it is considered a quick test, in 1998 an alternative methodology was proposed for the seed preconditioning, which allows 10 hours of time saving in seeds preparation. The objective of this research is to compare the accuracy of the new and the traditional tetrazolium testing. Three soybean seed genotypes were used, Conquista, Garantia and M-soy 8400, all 2000/2001 crop. The seeds were evaluated in relation to germination, evaluated with the traditional (TZt) and the alternative (Tza) tetrazolium test as well as with the accelerated aging performed in two different conditions (45 degrees C 24h(-1) and 45 degrees C 72h(-1)). After aging, the seeds too were submitted to TZt and Tza testing. The experimental design was a randomized blocks, with four replicates the 50 seeds per genotype in every evaluation, with exception only for tetrazolium test, with two replicates. The averages were compared in the Tukey test level of 5% probability. The comparison between the two methodologies in relation to level of vigor (class 1 to 3) and germination potential (class 1 to 5) indicated no statistical discrepancies, for aged non-aged seeds. This, the use of the alternative tetrazolium test is recommend in case a reduced seed preparation time is needed.
Resumo:
In the contemporary world to the deterioration of semi-arid areas of the planet has been the focus of media attention and the scientific community. Brazil has a semiarid, considered the most problematic of the world, either by pressure from physical factors, whether as a result of misguided public policies, has over time been suffering from the consequences of a deterioration that expands over the years. Methodologies, that amidst the problems of semi-arid, come against the deteriorating local, have a good chance to be reapplied in other contexts around the world. This research, based on methodological model for analyzing environmental deterioration, introduced and examined the applicability of the methodology in the semi-arid region of Rio Grande do Norte - Brazil. Although the results provide guidelines for the introduction of underground dams, the application of the methodology was ineffective, given the high rates of forest cover that gave low values for the physical diagnosis conservationist
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The study of sediment in water bodies presents great environmental importance, because of its ability to adsorb the pollutants, they may facilitate the understanding of the history of the current quality of the water system. Depending on how it is done the collection, analysis can show both a recent contamination as old. The detailed characterization of the sediment may reveal details that can understand how each type of pollutant interacts with the material given its composition. In this work it has developed a systematic methodology to characterize samples of sediment, with the aim to understand how a series of metal is distributed in different size fractions of the sediment. This study was conducted in five samples of sediment (P1, P2, P3a, P3B and P3c) collected in Jundiaí river, one of the most important tributaries of the river Potengi in the region of Macaíba, RN. The characterization was made with the samples previously sieved into meshes with different granulometries (+8#, -8+16#, -16+65# - 65+100#,-100+200#,-200+250# and -250#), using the following techniques: Analysis of specific surface area by BET method, determining the levels of organic matter (OM%) and humidity through the gravimetry and Analysis Thermogravimetric (TG), Infrared Spectroscopy in a Fourier transform (FTIR ), Analysis of X ray diffraction (XRD), analysis of heavy metals by optical emission spectrometry with the Argon Plasma (ICP-OES). The analyzed elements were Al, Cd, Cr, Cu, Fe, Mn, Ni, Zn and P. In addition to the techniques of characterization above, was also made the rebuilding of the samples P1, P2 and P3B in relation to the levels of organic matter and concentration of heavy metals. Then, the results of the recomposed samples were compared with those obtained in crude samples, showing great consistency. The gravimetry, used in determining the levels of organic matter, was not considered an appropriate method because the clay minerals present in the sediment samples analyzed fall apart in the same range of temperature (550-600 0C) used in roasting (600 0C). The results also showed the trend of organic matter and heavy metals to focus on the thin fractions, although the largest concentrations of metals are in intermediate fractions
Resumo:
The aiming of this work is linked to chemical education, focusing organic chemistry classes of Chemical Engineering, Pharmacy and Zootechny graduate courses of the Federal University of Rio Grande do Norte. For that, teaching-learning process related to basic chemical subjects which support the understanding of organic chemistry concepts was evaluated in a research period of two years. The education proposal linked to the theoretical content of the cited classes, pointed out the process of knowledge construction, in which educational commitment as well as dedication in the teaching-learning process was also valued. In that approach several didactic tools were applied, among them scientific articles were used as supplementary studies of the basic organic chemistry concepts and related. The acceptability of students, as well as their motivation, performance and learning process was justified by the data collection of the applied teaching methodology. The acceptability and commitment of the students facing this teaching interactive approach, which transversely contributed to the intellectual maturity growth of the students, as well their professional development, were evidenced by satisfactory obtained results that will be herein discussed
Resumo:
In this study, we worked with the validation of a methodology for analysis of bioactive amines in shrimp, considering it to be one of the main products of the northriograndense trade balance, maintaining the state of Rio Grande do Norte topped the list of Brazilian exports of this product the last decade. The sector of the Brazilian shrimp works exclusively with gray shrimp Litopenaeus Vannamei since the late 1990s. This study used liquid chromatography with conductimetric detector, using as the mobile phase methylsulfonic 3 mM acid (MSA) with gradient and phase C18 column with reverse the development of methodology for the analysis of bioactive amines in shrimp. In the sample preparation was used as 5% trichloroacetic acid (TCA) extraction solution. Validation analysis of biotativas amines (putrescine - PUT, histamine - HIST, agmatine - AGM, spermidine - EPD and spermine - EPN) in shrimp, the linear working range was 0.1 to 2.0 mg L-1 to was sensitive, homoscedastic, in effect, selective, accurate and precise array. Thus, considered feasible for these determinations bioactive amines in this array. Determined the concentration of these amines in fresh shrimps (AGM = 0.61 ± 0.05 mg kg- 1 EPD = 2.57 ± 0.14 mg kg-1 and EPN = 1.79 ± 0.11 mg kg-1), and freezing weather predetermined in cooked shrimp (AGM = 6.28 ± 0.18 mg kg-1, EPD = 12.72 ± 0.02 mg kg- 1 and EPN = 22.30 ± 0.60 mg kg-1), the shrimp with twenty-four hour stay at room temperature (PUT = 879.52 ± 28.12 mg kg-1, AGM = 848.13 ± 19.40 mg kg-1, ESPD = 13.59 ± 0.97 mg kg-1 and ESPN = 18.47 + 1.57 mg kg-1). In shrimp subjected to freezing for a week, two weeks, three weeks and four weeks, the results showed that there is an increase in the content of agmatine (7.31 ± 0.21 mg kg-1) while in spermine ( 1.22 ± 0.14 mg kg-1) and spermidine (below limit of quantification) there was a decrease in the freeze time, while there is a decrease in the level of spermidine not reaching detectad. The putrescine was only found in shrimp that remained for 24 hours at room temperature and histamine was not found in any of the samples
Resumo:
Foi desenvolvido um método para detectar e quantificar misturas de corantes em sucos artificiais em pó fabricados no Brasil, de diferentes marcas e sabores. Foram estudados 6 corantes artificiais: amarelo tartrazina, amarelo crepúsculo, vermelho ponceau 4R, vermelho bordeaux S, vermelho 40 e azul brilhante presentes de forma unitária ou em misturas nos sucos com sabores laranja, tangerina, maracujá, abacaxi, limão e uva. A identificação dos corantes nas amostras foi feita através da comparação com os espectros dos padrões, utilizando-se a análise por infravermelho médio e pelos respectivos valores de absorção máxima nos comprimentos de onda relativos aos padrões e valores de referência na literatura. Também foram estudados os perfis de decomposição térmica por termogravimetria, termogravimetria derivada e calorimetria diferencial exploratória dos corantes e dos sucos em pó, sendo determinados os teores de umidade, de matéria orgânica e de cinzas. O teor de umidade encontrado não ultrapassou 4% para todas as amostras de suco analisadas. Com relação ao teor de matéria orgânica obteve-se para 57% dos sucos analisados um teor médio de 51,3% e para 43% das outras amostras obteve-se uma média de 67,2 %. Os resultados obtidos para o teor de cinzas indicaram que 29% das amostras apresentaram um teor de 26,7% para esse parâmetro enquanto 71% das amostras apresentaram um teor de cinzas de 46,4%. Os resultados obtidos por análise térmica mostraram-se adequados considerando-se que para obter os resultados pelo método tradicional há um investimento maior de tempo, de pessoal envolvido e de material, além da proteção ao meio ambiente. Para a análise por espectroscopia de absorção molecular foi proposta uma equação simplificada para a determinação de cada corante na mistura utilizando-se a lei de Beer. Para validação, empregou-se a espectroscopia de absorção molecular no visível, onde foi investigada a influência dos interferentes (TiO2 e açúcar) presentes nas amostras de sucos, os testes de fotodegradação e a avaliação do efeito do pH. Para quantificação tomou-se como referência 512 amostras sintéticas contendo um e dois corantes (1,5625 a 25,000 mg L-1) para obtenção das curvas analíticas que foram aplicadas à análise dos sucos em pó. Os resultados indicaram que o teor máximo do amarelo crepúsculo foi encontrado nos sucos com os sabores laranja, tangerina e manga que correspondeu a 25,6% da ingestão diária aceitável (para ser ultrapassada corresponderia a ingestão de 4 copos). O teor máximo encontrado para o amarelo tartrazina nos sucos foi para o sabor maracujá que correspondeu a 8,5% da ingestão diária aceitável, (para ser alcançado corresponderia a ingestão de 12 copos). O método proposto foi testado e validado com sucesso para amostras de sucos em pó sendo de simples execução e de rapidez na obtenção dos resultados
Resumo:
Hylocereus undatus (Haw.), popularmente conhecida como pitaia vermelha é uma cactácea para a qual se tem registrado um aumento de consumo nos últimos anos e, por ser ainda pouco explorada, vários aspectos referentes à sua propagação ainda são desconhecidos. Até o momento, não existem critérios para a execução de testes de germinação para sementes dessa espécie, publicados nas Regras para Análise de Sementes. Nesse sentido, objetivou-se com este trabalho adequar a metodologia quanto ao substrato, temperatura e tempo de contagem inicial e final para o teste de germinação. Foram testados quatro substratos (rolo de papel, areia, vermiculita e solo) e quatro temperaturas (20, 25, 30 e 20-30°C). O efeito dos substratos no desempenho germinativo das sementes foi avaliado pelo teste de germinação e de primeira contagem instalado com quatro subamostras de 50 sementes. Foram feitas contagens diárias do número de plântulas emergidas até atingirem a estabilidade e, no final do experimento, foram avaliados a porcentagem de germinação das sementes, considerando as plântulas normais, anormais e sementes mortas. Concluiu-se que o teste de germinação de sementes de pitaia vermelha deve ser realizado à temperatura constante de 25°C em rolo de papel, com contagens inicial e final aos cinco e dez dias após a semeadura, respectivamente.
Resumo:
The use of high vigor seed constitutes basic and fundamental. Given the increasing development os the seeds industry and the improvement of vigor tests used to differentiate subtle variations in the quality of seeds of vegetable crops, is needed. The objective was to study variations in conducting the accelerated aging test, to verify their sensitivity for identifying different vigor levels of arugula seed. Were used the cultivars Cultivada and Gigante, using five lots of seeds for each. The seeds were subjected to the determination of water content, germination, first germination, emergence of seedlings and variations in the accelerated aging test, without salt solution ( traditional procedure) and with salt solution in 48, 72 and 96 hours; at 38 degrees C, 41 degrees C and 45 degrees C. The accelerated aging test in traditional procedure is not efficient to evaluation the vigor of arugula seeds. The accelerated aging test with saline solution using the combination 41 degrees C for 72 hours, was sensitive to evaluated of the physiological potential of arugula seeds.
Resumo:
OBJETIVO: comparar duas metodologias para o cálculo do volume placentário em gestações normais de termo: a do princípio de Arquimedes e a do volume do cilindro, para estimar a densidade absoluta da placenta. Definir a metodologia mais adequada para o cálculo do volume e densidade placentários, que se relacione com o peso e classificação do recém-nascido. MÉTODOS: foram estudadas 50 placentas provenientes de gestações de termo sem complicações e calculados o volume e a densidade absoluta placentários: a) pelo princípio de Arquimedes e b) na suposição de que a placenta seria uma secção de cilindro com duas alturas diferentes do bolo placentário: com a altura média e com a altura da média aritmética do centro e extremidades. As densidades absolutas placentárias foram calculadas pelo quociente entre o peso ao ar da placenta e os diferentes volumes. RESULTADOS: a maioria das gestantes eram multíparas, idade média de 25,4 anos, volume placentário médio entre 547,8 e 610 cm³ e densidade média entre 0,94 e 1,14 g/cm³, dependendo da metodologia empregada. CONCLUSÕES: a metodologia mais adequada para estimar o volume placentário no termo foi a do princípio de Arquimedes, pela melhor correlação com o peso dos recém-nascidos, o índice placentário e a classificação do peso dos recém-nascidos em relação à idade gestacional.
Resumo:
Este artigo apresenta o desenvolvimento, validação e utilização de uma metodologia de avaliação da qualidade dos serviços de atenção primária do Sistema Único de Saúde (SUS), o Questionário de Avaliação da Qualidade de Serviços de Atenção Básica (QualiAB). Destina-se aos serviços de atenção básica, organizados segundo diferentes modelos de atenção, incluindo a Saúde da Família. Contém 50 indicadores sobre oferta e organização do trabalho assistencial e programático e 15 sobre gerenciamento, na forma de questões de múltipla escolha, autorespondidas via web pela equipe local do serviço. Confere a cada resposta valor zero, um ou dois; a média geral atribui ao serviço um grau de qualidade expresso pela distância do melhor padrão correspondente à média dois. Foi construído por processo de consenso interativo, que incluiu metodologias qualitativas, teste-piloto, aplicação em 127 serviços, validação de construto e confiabilidade. Respondido, em 2007, por 598 (92%) dos serviços de 115 municípios paulistas, mostrou bom poder para discriminar níveis de qualidade. Adotado em 2010 como parte de um programa de apoio à Atenção Básica da Secretaria de Estado da Saúde de São Paulo, foi respondido por 95% (2.735) dos serviços de 586 municípios (90,8% do Estado). Os resultados foram encaminhados aos municípios. O QualiAB fornece uma avaliação válida, simples e com a possibilidade de retorno imediato para gerentes e profissionais. Mostrou factibilidade, aceitabilidade, bom poder de discriminação e utilidade para auxiliar a gestão da rede de atenção básica do SUS em São Paulo. A experiência indica aplicabilidade nas redes de atenção básica do Brasil.
Resumo:
Os estudos das secreções traqueobrônquicas são amplamente utilizados nas pesquisas de doenças pulmonares nas diversas espécies animais, inclusive no homem. Os objetivos desta pesquisa foram a viabilização da técnica de colheita de lavado traqueobrônquico na espécie ovina e o estudo da relação clínico-citológica do lavado de ovinos portadores de broncopneumonia e sadios. Foram utilizados 33 ovinos, 18 sadios e 15 portadores de enfermidade respiratória com sinais clínicos de envolvimento das vias aéreas, divididos nos respectivos grupos, GS e GD. Após o exame físico foi realizado o lavado traqueobrônquico por via nasotraqueal. A colheita do lavado foi feita com a inoculação e aspiração de solução fisiológica estéril. As amostras foram processadas citologicamente através de citocentrifugação e coradas pelos métodos Wright-Giemsa e Shorr. Tanto a contagem total de células epiteliais quanto o número de hemácias por mililitro foi maior no grupo de animais com broncopneumonia. Nos animais sadios notou-se predomínio de macrófagos, seguido por células epiteliais cilíndricas, neutrófilos e linfócitos. No grupo de animais doentes havia menor número de macrófagos, e predomínio da população de neutrófilos. Por ser de fácil realização, pouco dispendiosa e pela obtenção representativa de material, a técnica estudada mostrou-se eficaz na obtenção de fluidos traqueobrônquicos e, portanto um bom método de colheita de células para uso nas pesquisas de vias aéreas.