Characterisation of bifunctional ruthenium(ii) complexes, potential DNA photo-probes. Presence of folded and unfolded conformers

Novel bifunctional ruthenium(n) complexes, [Ru(TAP)2(POQ-Nmet)]2+ and [Ru(BPY)2(POQ-Nmet)]2+(la, 2a), containing a metallic and an organic moiety, have been prepared as photoprobes and photoreagents of DNA(TAP = 1,4,5,8-tetraazaphenanthrene, POQ-Nmet = 5-[6-(7-chloroquinolin-4-yl)-3-thia-6-azaheptanamido]-l,10phenanthroline). The ES mass spectrometry and 'H NMR data in organic solvents indicate that the quinoline moiety exists in both the protonated and non-protonated form. Moreover, the comparison of the NMR data with those of the corresponding monofunctional complexes(without quinoline) evidences that [Ru(TAP).2(POQ-Nmet)]2+ and [Ru(BPY)J(POQ-Nmet)]2+ are unfolded when the quinoline unit is protonated whereas deprotonation permits folding of the molecule. In the folded state the spatial proximity of the electron donor(the organic moiety) and electron acceptor(the metallic moiety) in [Ru(TAP)2(POQ-Nmet)]2+ favours intramolecular photo-induced electron transfer, which has been shown in a previous study to be responsible for the very low luminescence of la in non-protonating solutions. The restoration of the luminescence by protonation of the quinoline moiety as observed previously is in agreement with the unfolding of the molecule demonstrated in this work. The existence of such folding-unfolding processes related to protonation is crucial for studies of la with DNA. © The Royal Society of Chemistry 2000.

Photophysics of bifunctional Ru(II) complexes bearing an aminoquinoline organic unit. Potential new photoprobes and photoreagents of DNA

[Ru(BPY)2POQ-Nmet]2+ and [Ru(TAP)2POQ-Nmet]2+ (1 and 3) are bifunctional complexes composed of a metallic unit linked by a flexible chain to an organic unit. They have been prepared as photoprobes or photoreagents of DNA. In this work, the spectroscopic properties of these bifunctional complexes in the absence of DNA are compared with those of the monofunctional analogues [Ru(BPY)2Phen]2+, [Ru-(BPY)2acPhen]2+, [Ru(TAP)2Phen]2+, and [Ru(TAP)2acPhen]2+ (2 and 4). The electrospray mass spectrometry and absorption data show that the quinoline moiety exists in the protonated and nonprotonated form. Although the bifunctional complex containing 2,2′-bipyridine (BPY) ligands exhibits photophysical properties similar to those of the monofunctional compounds, the bifunctional complex with 1,4,5,8-tetraazaphenanthrene (TAP) ligands behaves quite differently. It has weaker relative emission quantum yields and shorter luminescence lifetimes than the monofunctional TAP analogue when the quinoline unit is nonprotonated. This indicates an efficient intramolecular quenching of the 3MLCT (metal to ligand charge transfer) excited state of the TAP metallic moiety. When the organic unit is protonated, there is no internal quenching. In organic solvent, the nonquenched excited metallic unit (bearing a protonated quinoline) and the quenched one (bearing a nonprotonated organic unit) are in slow equilibrium as compared to the lifetime of the two emitters. In aqueous solution this equilibrium is faster and is catalysed by the presence of phosphate buffer. Flash photolysis experiments suggest that the intramolecular quenching process originates from a photoinduced electron transfer from the nonprotonated quinoline to the excited Ru(TAP)2 2+ moiety.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Bis(trifluoromethyl)mercury(II) complexes with purine and 3,5-dimethyl-4 '-amino-triazole as ligands, [Hg(CF3)(2)(Pur)](4) and [Hg(CF3)(2)(Dat)](2)

Colourless single crystals of [Hg(CF3)(2)(Pur)](4) and [Hg(CF3)(2)(Dat)](2) were obtained from aqueous and etheric solutions of the respective components Purine, (imidazo[4,5-d]pyrimidine, Pur), 3,5-dimethyl-4 '-amino-triazole (Dat) and bis(trifluoromethyl)mercury(II), Hg(CF3)(2). [Hg(CF3)(2)(Pur)](4) crystallizes with the tetragonal system (P-4, Z = 8, a = 1486.8(2), c = 1026.2(l) pm, R-all = 0.0657) with tetrameric molecules consisting of four purine molecules bridged by slightly bent Hg(CF3)2 molecules forming a cage with the CF3 ligands surrounding this cage. The two modifications of [Hg(Dat)(CF3)2]2 (1: 170 K, triclinic, P-1, Z = 2, a 814.9(2), b = 845.4(2), c = 968.4(3) pm, alpha = 106.55(2)degrees, beta= 103.41(2)degrees, gamma = 110.79(2)degrees, R-all = 0.1189; II: monoclinic, P2(1)/c, Z = 8, a = 879.8(2), b = 1731.0(3), c = 1593.9(3) pm, beta = 106.89(2)degrees, R-all = 0.1199) both contain dimeric molecules that are stacked parallel to one crystal axis to strands which are arranged in a parallel fashion in I and rotated against each other in 11 by 110 degrees. In both, the tetrameric [Hg(CF3)(2)(Pur)](4) and the dimeric [Hg(CF3)(2)(Dat)](2) the Hg(CF3)(2) molecules are slightly bent (around 167 and 170 degrees) and rather weakly attached to the N-donor ligands Pur and Dat with Hg-N distances around 272 pm, although in both cases the Hg atoms bridge between two ligand molecules.

Cobalt(II) Complexes of Nitrile-Functionalized Ionic Liquids

A series of nitrile-functionalized ionic liquids were found to exhibit temperature-dependent miscibility (thermomorphism) with the lower alcohols. Their coordinating abilities toward cobalt(II) ions were investigated through the dissolution process of cobalt(II) bis(trifluoromethylsulfonyl)imide and were found to depend on the donor abilities of the nitrile group. The crystal structures of the cobalt(II) solvates [Co(C1C1CNPyr)2(Tf2N)4] and [Co(C1C2CNPyr)6][Tf2N]8, which were isolated from ionic-liquid solutions, gave an insight into the coordination chemistry of functionalized ionic liquids. Smooth layers of cobalt metal could be obtained by electrodeposition of the cobalt-containing ionic liquids.

Anionic N,O-ligated Pd(II) complexes: highly active catalysts for alcohol oxidation.

There is a need to develop effective catalytic methods for alcohol oxidation. Pd(II) complexes have shown great promise as catalysts, however a comparatively small number of ligands have been reported so far. Herein we report the use of commercially available anionic N,O-ligands to produce highly active catalysts.

Sequential C-H and C-Ru bond formation and cleavage during the thermally induced rearrangement of aryl ruthenium(II) complexes with [C6H3(CH2NMe2)(2)-2,6](-) as a bidentate eta(2)-C,N coordinated ligand. The crystal structures of the isomeric pairs [RuCl{eta(6)-C10H14}{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,n}] (n = 4 or 6) and [Ru(eta(5)-C5H5){(eta(2)-C,N-C6H3(CH2NMe2)(2)-2,n} (PPH3)] (n = 4 or 6)

New air-stable ruthenium(II) complexes that contain the aryldiamine ligand [C6H3(CH2-NMe2)(2)-2,6](-) (NCN) are described. These complexes are [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(6)-C10H14)] (2; C10H14 = p-cymene = C6H4Me-Pr-i-4), [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(5)-C5H5)(PPh3)] (5), and their isomeric forms [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(6)-C10H14)] (3) and [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(5)-C5H5)(PPh3)] (6), respectively. Complex 2 has been prepared from the reaction of [Li(NCN)](2) with [RuCl2(eta(6)-C10H14)](2), whereas complex 5 has been prepared by the treatment of [RuCl{eta(3)-N,C,N-C6H3(CH2NMe2)(2)-2,6}(PPh3)] (4) with [Na(C5H5)](n). Both 2 and 5 are formally 18-electron ruthenium(II) complexes in which the monoanionic potentially tridentate coordinating ligand NCN is eta(2)-C,N-bonded, In solution (halocarbon solvent at room temperature or in aromatic solvents at elevated temperature), the intramolecular rearrangements of 2 and 5 afford complexes 3 and 6, respectively. This is a result of a shift of the metal-C-aryl bond from position-1 to position-3 on the aromatic ring of the NCN ligand. The mechanism of the isomerization is proposed to involve a sequence of intramolecular oxidative addition and reductive elimination reactions of both aromatic and aliphatic C-H bonds. This is based on results from deuterium labeling, spectroscopic studies, and some kinetic experiments. The mechanism is proposed to contain fully reversible steps in the case of 5, but a nonreversible step involving oxidative addition of a methyl NCH2-H bond in the case of 2. The solid-state structures of complexes 2, 3, 5, and 6 have been determined by single-crystal X-ray diffraction. A new dinuclear 1,4-phenylene-bridged bisruthenium(II) complex, [1,4-{RuCl(eta(6)-C10H14)}(2){C-6(CH2NMe2)(4)-2,3,5,6-C,N,C',N'}] (9) has also been prepared from the dianionic ligand [C-6(CH2NMe2)(4)-2,3,5,6](2-) (C2N4). The C2N4 ligand is in an eta(2)-C,N-eta(2)-C',N'-bis(bidentate) bonding mode. Compound 9 does not isomerize in solution (halocarbon solvent), presumably because of the absence of an accessible C-aryl-H bond. Complex 9 could not be isolated in an analytically pure form, probably because of its high sensitivity to air and very low solubility, which precludes recrystallization.

Double cyclometalation via carbon-silicon bond cleavage by palladium(II) acetate. X-ray structure of a cationic 1,4-dipalladated benzene ring and selective synthesis of heterobimetallic 1,4-phenylene-bridged platinum(II)-palladium(II) complexes

The disilylated compound 1,4-bis(trimethylsilyl)-2,3,5,6-tetrakis((dimethylamino)methyl)benzene, (Me(3)Si)(2)C2N4, 4, can be electrophilically palladated selectively at the C-Si bonds to afford the neutral 1,4-bis(palladium) complex [(AcOPd)(2)(C2N4)], from which the dicationic [(LPd)(2)(C2N4)](2+) (L = MeCN) organometallic species are accessible. The monosilylated species (Me(3)Si)(H)C2N4, 5, can be used for the preparation of the dicationic heterodinuclear platinum(II)-palladium(II) species [(LPd)(LPt)(C2N4)](2+) (L = MeCN) via a sequence of transmetalation of the organolithium derivative of 5 with [PtCl2(SEt(2))(2)], followed by a C-Si bond palladation reaction.

New ruthenium(II) complexes of functionalized monoanionic aryldiamine N,C,N'-terdentate ligands: Syntheses of [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl+(-); X-ray structure of a dimeric organolithium compound,[Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2)

The new anionic functionalized aryldiamine ligands [2,6-(Me(2)NCH(2))(2)-4-R-C6H2](-) (R = Me(3)SiC=C, C6H5, Me(3)Si), formally derived from [2,6-(Me(2)NCH(2))(2)C6H3](-), have been prepared as their lithium compounds. The compound [Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2) crystallizes in the monoclinic space group C2/c (no. 15) with a = 13.1225(5), b = 13.5844(7), c = 15.9859(12) Angstrom, beta = 105.329(5)degrees, V = 3264.0(3)Angstrom(3), Z = 4. The structure refinement converged to R(1) = 0.0374 for 2037 observed reflections [F-o>4 sigma(F-o)] and wR(2) = 0.0922 for 2560 unique data. The organolithium compounds have been used in transmetalation reactions to give the corresponding functionalized organoruthenium(II) complexes [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl-+(-) (terpy = 2,2';6',2 ''-terpyridine). The Ru-II species with R = HC = C has also been synthesized.

Versatile N,C,N coordination behavior of a monoanionic aryldiamine ligand in ruthenium(II) complexes: Syntheses and crystal structures of [Ru-II(C6H3(CH(2)NMe(2))(2)-2,6)X(L)] (L equals norbornadiene, X=Cl, SO3CF3; L=PPh(3), X=I) and [Ru-II{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6:2''-terpyridine)]Cl

The monoanionic ligand [C6H3(CH(2)NMe(2))(2)-2,6](-), a potentially terdentate N,C,N bonding system, has been employed to synthesize a series of new ruthenium(II) complexes [Ru{C6H3(CH(2)NMe(2))(2)-2,6}X(L)] (L = PPh(3) X = Cl (2a), I (2b); L = norbornadiene (nbd), X = Cl (4), eta(1)-OSO2CF3 (5)) and [Ru{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6',2 ''-terpyridine)]Cl (3). X-ray crystal structures of 2b and 3-5 have been determined, in which the N,C,N coordination geometry with respect to the metal center is found to differ considerably. In each complex the aryldiamine ligand is terdentate, eta(3)-N,C,N-bonded as a six electron donor system. However, depending on the other ligands in the Ru(II) coordination sphere, this ligand demonstrates considerable flexibility in adopting coordination geometries which range from meridional in 3 through pseudomeridional in 2b to pseudofacial in 4 and 5. In the structures of 4 and 5 significant distortions of the aryl ring, involving bending of the six-membered ring into a boatlike conformation, are found. The different combinations of the N,C,N ligand with sets of other ligands lead to a range of metal geometries, i.e. square pyramidal in 2b, octahedral in 3, and bicapped tetrahedral in 4 and 5.