Registros de representación semiótica en el concepto “resolución numérica de ecuaciones polinómicas”. Análisis a priori

Analizamos los registros de representación semiótica y las correspondientes funciones semióticas implícitos en la solución de dos problemas propuestos para la Educación Polimodal, que consideramos pueden ser utilizados en el proceso de enseñanza-aprendizaje de la noción resolución numérica de ecuaciones polinómicas, contemplada en los C.B.C. del mencionado nivel. Las representaciones juegan un rol fundamental en los procesos de construcción de conceptos, por lo que son importantes en la enseñanza, aprendizaje y comunicación del conocimiento matemático (Hitt, 1996). Con este análisis a priori, pretendemos ver cuáles de los registros de representación son de mayor peso para incorporar o darle sentido al concepto: Funciones polinómicas. Raíces de las correspondientes ecuaciones. Tratamos de responder a las preguntas: ¿Cuáles son los distintos registros de representación puestos en juego en la solución de cada problema?. ¿C��mo se suceden?. ¿C��mo aparecen y cuál es la necesidad de su conversión?. ¿C��mo se coordinan en la actividad conceptual? ¿En qué medida la presentación del tema desde una situación problemática es beneficiosa para incorporar y dar sentido a la determinación de las raíces de una ecuación polinómica?.

Effect of lesion morphology on microwave signature in 2-D ultra-wideband breast imaging

This paper studies the possibility of distinguishing between benign and malignant masses by exploiting the morphology-dependent temporal and spectral characteristics of their microwave backscatter response in ultra-wideband breast cancer detection. The spiculated border profiles of 2-D breast masses are generated by modifying the baseline elliptical rings based upon the irregularity of their peripheries. Furthermore, the single- and multilayer lesion models are used to characterize a distinct mass region followed by a sharp transition to background, and a blurred mass border exhibiting a gradual transition to background, respectively. Subsequently, the complex natural resonances (CNRs) of the backscatter microwave signature can be derived from the late-time target response and reveal diagnostically useful information. The fractional sequence CLEAN algorithm is proposed to estimate the lesions' delay intervals and identify the late-time responses. Finally, it is shown through numerical examples that the locations of dominant CNRs are dependent on the lesion morphologies, where 2-D computational breast phantoms with single and multiple lesions are investigated. The analysis is of potential use for discrimination between benign and malignant lesions, where the former usually possesses a better-defined, more compact shape as opposed to the latter.

Time-reversal ultrawideband breast imaging: pulse design criteria considering multiple tumors with unknown tissue properties

Pulse design is investigated for time-reversal (TR) imaging as applied to ultrawideband (UWB) breast cancer detection. Earlier it has been shown that a suitably-designed UWB pulse may help to improve imaging performance for a single-tumor breast phantom with predetermined lesion properties. The current work considers the following more general and practical situations: presence of multiple malignancies with unknown tumor size and dielectric properties. Four pulse selection criteria are proposed with each focusing on one of the following aspects: eliminating signal clutter generated by tissue inhomogeneities, canceling mutual interference among tumors, improving image resolution, and suppressing artifacts created by sidelobe of the target response. By applying the proposed criteria, the shape parameters of UWB waveforms with desirable characteristics are identified through search of all the possible pulses. Simulation example using a numerical breast phantom, comprised of two tumors and structured clutter distribution, demonstrates the effectiveness of the proposed approach. Specifically, a tradeoff between the image resolution and signal-to-clutter contrast (SCC) is observed in terms of selection of the excitation waveforms.

Nomenclature and syntaxonomic notes on some high-rank syntaxa of the European grassland vegetation

We present descriptions of a new order (Ranunculo cortusifolii-Geranietalia reuteri and of a new alliance (Stachyo lusitanicae-Cheirolophion sempervirentis) for the herbaceous fringe communities of Macaronesia and of the southwestern Iberian Peninsula, respectively. A new alliance, the Polygalo mediterraneae-Bromion erecti (mesophilous post-cultural grasslands), was introduced for the Peninsular Italy. We further validate and typify the Armerietalia rumelicae (perennial grasslands supported by nutrient-poor on siliceous bedrocks at altitudes characterized by the submediterranean climate of central-southern Balkan Peninsula), the Securigero-Dasypyrion villosae (lawn and fallow-land tall-grass annual vegetation of Italy), and the Cirsio vallis-demoni-Nardion (acidophilous grasslands on siliceous substrates of the Southern Italy). Nomenclatural issues (validity, legitimacy, synonymy, formal corrections) have been discussed and clarified for the following names: Brachypodio-Brometalia, Bromo pannonici-Festucion csikhegyensis, Corynephoro-Plantaginion radicatae, Heleochloion, Hieracio-Plantaginion radicatae, Nardetea strictae, Nardetalia strictae, Nardo-Callunetea, Nardo-Galion saxatilis, Oligo-Bromion, Paspalo-Heleochloetalia, Plantagini-Corynephorion and Scorzoneret alia villosae. 

Advanced glycation end products induce blood-retinal barrier dysfunction in normoglycemic rats

Advanced glycation end products (AGEs) have been implicated in the progressive vascular dysfunction which occurs during diabetic retinopathy. In the current study we have examined the role of these adducts in blood-retinal barrier (BRB) breakdown and investigated expression of the vasopermeabilizing agent vascular endothelial growth factor (VEGF) in the retina. When normoglycemic rats were injected with AGE-modified albumin daily for up to 10 days there was widespread leakage of FITC-dextran and serum albumin from the retinal vasculature when compared to control animals treated with nonmodified albumin. Ultrastructural examination of the vasculature revealed areas of attenuation of the retinal vascular endothelium and increased vesicular organelles only in the AGE-exposed rats. Quantitative RT-PCR and in situ hybridization demonstrated a significant increase in retinal VEGF mRNA expression (P <0.05). These results suggest that AGEs can initiate BRB dysfunction in nondiabetic rats and a concomitant increase in retinal VEGF expression. These findings may have implications for the role of AGEs in the pathogenesis of diabetic retinopathy.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

The Septin-Binding Protein Anillin is Over-Expressed in Diverse Human Tumours

Anillin is an actin-binding protein that can bind septins and is a component of the cytokinetic ring. We assessed the anillin expression in 7,579 human tissue samples and cell lines by DNA micro-array analysis. Anillin is expressed ubiquitously but with variable levels of expression, being highest in the central nervous system. The median level of anillin mRNA expression was higher in tumors than normal tissues (median fold increase 2.58; 95% confidence intervals, 2.19-5.68, P < 0.0001) except in the central nervous system where anillin in RNA levels were lower in tumors. We developed a sensitive reverse transcription-PCR strategy to show that anillin mRNA is expressed in cell lines and in cDNA panels derived from fetal and adult tissues, thus validating the microarray data. We compared anillin with Ki67 in RNA expression and found a significant linear relationship between anillin and Ki67 mRNA expression (Spearmann r similar to 0.6, P < 0.0001). Anillin mRNA expression was analyzed during tumor progression in breast, ovarian, kidney, colorectal, hepatic, lung, endometrial, and pancreatic tumors and in all tissues there was progressive, increase in anillin mRNA expression from normal to benign to malignant to metastatic disease. Finally, we used anti-anillin sera and found nuclear anillin immuncireactivity to be widespread in normal tissues, often not correlating with proliferative compartments. These data provide insight into the existence of non proliferation-associated activities of anillin and roles in interphase nuclei. Thus, anillin is overexpressed in diverse common human tumors, but not simply as a consequence of being a proliferation marker. Anillin may have potential as a novel biomarker.

IntCal04 terrestrial radiocarbon age calibration, 0-26 cal kyr BP

A new calibration curve for the conversion of radiocarbon ages to calibrated (cal) ages has been constructed and internationally ratified to replace IntCal98, which extended from 0-24 cal kyr BP (Before Present, 0 cal BP = AD 1950). The new calibration data set for terrestrial samples extends from 0-26 cal kyr BP, but with much higher resolution beyond 11.4 cal kyr BP than IntCal98. Dendrochronologically-dated tree-ring samples cover the period from 0-12.4 cal kyr BP. Beyond the end of the tree rings, data from marine records (corals and foraminifera) are converted to the atmospheric equivalent with a site-specific marine reservoir correction to provide terrestrial calibration from 12.4-26.0 cal kyr BP. A substantial enhancement relative to IntCal98 is the introduction of a coherent statistical approach based on a random walk model, which takes into account the uncertainty in both the calendar age and the (super 14) C age to calculate the underlying calibration curve (Buck and Blackwell, this issue). The tree-ring data sets, sources of uncertainty, and regional offsets are discussed here. The marine data sets and calibration curve for marine samples from the surface mixed layer (Marine04) are discussed in brief, but details are presented in Hughen et al. (this issue a). We do not make a recommendation for calibration beyond 26 cal kyr BP at this time; however, potential calibration data sets are compared in another paper (van der Plicht et al., this issue).