Hydrogen adsorption in a copper ZSM5 zeolite: an inelastic neutron scattering study

Currently microporous oxidic materials including zeolites are attracting interest as potential hydrogen storage materials. Understanding how molecular hydrogen interacts with these materials is important in the rational development of hydrogen storage materials and is also challenging theoretically. In this paper, we present an incoherent inelastic neutron scattering (INS) study of the adsorption of molecular hydrogen and hydrogen deuteride (HD) in a copper substituted ZSM5 zeolite varying the hydrogen dosage and temperature. We have demonstrated how inelastic neutron scattering can help us understand the interaction of H-2 molecules with a binding site in a particular microporous material, Cu ZSM5, and by implication of other similar materials. The H-2 molecule is bound as a single species lying parallel with the surface. As H-2 dosing increases, lateral interactions between the adsorbed H-2 molecules become apparent. With rising temperature of measurement up to 70 K (the limit of our experiments), H-2 molecules remain bound to the surface equivalent to a liquid or solid H-2 phase. The implication is that hydrogen is bound rather strongly in Cu ZSM5. Using the simple model for the anisotropic interaction to calculate the energy levels splitting, we found that the measured rotational constant of the hydrogen molecule is reduced as a consequence of adsorption by the Cu ZSM5. From the decrease in total signal intensity with increasing temperature, we were able to observe the conversion of para-hydrogen into ortho-hydrogen at paramagnetic centres and so determine the fraction of paramagnetic sites occupied by hydrogen molecules, ca. 60%. (c) 2006 Elsevier B.V. All rights reserved.

Supramolecular hydrogen-bond structures and magnetic interactions in basal-apical, dinuclear, azide-bridged copper(II) complexes

The synthesis, characterisation, X-ray single crystal structures and magnetic properties of three new basal-apical mu(2)-1,1-azide-bridged complexes [(CuLN3)-N-1](2) (1), [(CuLN3)-N-2](2) (2) and [(CuLN3)-N-3](2) (3) with very similar tridentate Schiff-base blocking ligands {HL1 = N-[2-(ethylamino) ethyl] salicylaldimine; HL2 = 7-(ethylamino)-4-methyl-5-azahept-3-en-2-one; HL3 = 7-amino-4-methyl-5-azaoct-3-en-2-one} have been reported [complex 1: monoclinic, P2(1)/c, a = 8.390(2), b = 7.512(2), c = 19.822(6) Angstrom, beta = 91.45(5)degrees; complex 2: monoclinic, P2(1)/c, a = 8.070(9), b = 9.787(12), c = 15.743(17) A, beta = 98.467(10)degrees; complex 3: monoclinic, P2(1)/n, a = 5.884(7), b = 16.147(18), c = 11.901(12) Angstrom, beta = 90.050(10)degrees]. The structures consist of neutral dinuclear entities resulting from the pairing of two mononuclear units through end-on azide bridges connecting an equatorial position of one copper centre to an axial position of the other, The copper ions adopt a (4+1) square-based geometry in all the complexes. In complex 2, there is no inter-dimer hydrogen-bonding. However, complexes 1 and 3 form two different supramolecular structures in which the dinuclear entities are linked by H-bonds giving one-dimensional systems. Variable temperature (300-2 K) magnetic-susceptibility measurements and magnetisation measurements at 2 K reveal that all three complexes have antiferromagnetic coupling. Magneto-structural correlations have been made taking into consideration both the azido bridging ligands and the existence of intermolecular hydrogen bonds. ((C) Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2004).

DNA cleavage and antitumour activity of platinum(II) and copper(II) compounds derived from 4-methyl-2-N-(2-pyridylmethyl)aminophenol: spectroscopic, electrochemical and biological investigation

The reaction of the redox-active ligand, Hpyramol (4-methyl-2-N-(2-pyridylmethyl)aminophenol) with K2PtCl4 yields monofunctional square-planar [Pt(pyrimol)Cl], PtL-Cl, which was structurally characterised by single-crystal X-ray diffraction and NMR spectroscopy. This compound unexpectedly cleaves supercoiled double-stranded DNA stoichiometrically and oxidatively, in a non-specific manner without any external reductant added, under physiological conditions. Spectro-electrochemical investigations of PtL-Cl were carried out in comparison with the analogue CuL-Cl as a reference compound. The results support a phenolate oxidation, generating a phenoxyl radical responsible for the ligand-based DNA cleavage property of the title compounds. Time-dependent in vitro cytotoxicity assays were performed with both PtL-Cl and CuL-Cl in various cancer cell lines. The compound CuL-Cl overcomes cisplatin-resistance in ovarian carcinoma and mouse leukaemia cell lines, with additional activity in some other cells. The platinum analogue, PtL-Cl also inhibits cell-proliferation selectively. Additionally, cellular-uptake studies performed for both compounds in ovarian carcinoma cell lines showed that significant amounts of Pt and Cu were accumulated in the A2780 and A2780R cancer cells. The conformational and structural changes induced by PtL-Cl and CuL-Cl on calf thymus DNA and phi X174 supercoiled phage DNA at ambient conditions were followed by electrophoretic mobility assay and circular dichroism spectroscopy. The compounds induce extensive DNA degradation and unwinding, along with formation of a monoadduct at the DNA minor groove. Thus, hybrid effects of metal-centre variation, multiple DNA-binding modes and ligand-based redox activity towards cancer cell-growth inhibition have been demonstrated. Finally, reactions of PtL-Cl with DNA model bases (9-Ethylguanine and 5'-GMP) followed by NMR and MS showed slow binding at Guanine-N7 and for the double stranded self complimentary oligonucleotide d(GTCGAC)(2) in the minor groove.

Synthesis, crystal structure and reactivity of copper(II) complexes of tetradentate N2S2 donor ligands

Two new hexa-coordinated mononuclear copper(II) complexes of two ligands L-1 and L-2 containing NSSN donor sets formulated as [Cu(L)(H2O)(2)](NO3)(2) [1a, L = 1,2-bis(2-pyridylmethylthio)ethane (L-1), 1b L = 1,3-bis(2-pyridyl-methylthio)propane (L-2)] were synthesized and characterized by physico-chemical and spectroscopic methods. In 1a the single crystal X-ray crystallography analysis showed a distorted octahedral geometry about copper(II) ion. The crystal packing evidences pairs of complexes arranged about a center of symmetry and connected through a H-bond occurring between aquo ligands and nitrate anions. On reaction with chloride and pseudohalides (N-3(-) and SCN-), in acetonitrile at ambient temperature. complexes 1 changed to monocationic penta-coordinated mononuclear copper(H) species formulated as [Cu(L)(Cl)]NO3 (2), [Cu(L)(N-3)]NO3 (3). and [Cu(L)(SCN)]NO3 (4). These copper(II) complexes have been isolated in pure form from the reaction mixtures and characterized by physico-chemical and spectroscopic tools. The solid-state structure of 2a, established by X-ray crystallography, shows a trigonal bipyramidal geometry about the metal ion with a trigonality index (tau) of 0.561. (C) 2009 Elsevier B.V. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Synthesis, crystal structure and magnetic properties of three unprecedented tri-nuclear and one very rare tetra-nuclear copper(II) Schiff-base complexes supported by mixed azido/phenoxo/nitrato or acetato bridges

Three novel mixed bridged trinuclear and one tetranuclear copper(II) complexes of tridentate NNO donor Schiff base ligands [Cu-3(L-1)(2)(mu(LI)-N-3)(2)(CH3OH)(2)(BF2)(2)] (1), [Cu-3(L-1)(2)(mu(LI)-NO3-I kappa O.2 kappa O')(2)] (2), [Cu-3(L-2)(2)(mu(LI)-N-3)(2)(mu-NOI-I kappa O 2 kappa O')(2)] (3) and [Cu-4(L-3)(2)(mu(LI)-N-3)(4)(mu-CH3COO-I kappa O 2 kappa O')(2)] (4) have been synthesized by reaction of the respective tridentate ligands (L-1 = 2[1-(2-dimethylamino-ethylimino)-ethyl]-phenol, L-2 = 2[1-(2-diethylamino-ethylimino)-ethyl]-phenol, L-3 = 2-[1-(2-dimethylamino-ethylimino)-methyl]-phenol) with the corresponding copper(II) salts in the presence of NaN3 The complexes are characterized by single-crystal X-ray diffraction analyses and variable-temperature magnetic measurements Complex 1 is composed of two terminal [Cu(L-1)(mu(LI)-N-3)] units connected by a central [Cu(BF4)(2)] unit through nitrogen atoms of end-on azido ligands and a phenoxo oxygen atom of the tridentate ligand The structures of 2 and 3 are very similar, the only difference is that the central unit is [Cu(NO1)(2)] and the nitrate group forms an additional mu-NO3-I kappa O 2 kappa O' bridge between the terminal and central copper atoms In complex 4, the central unit is a di-mu(L1)-N-3 bridged dicopper entity, [Cu-2(mu(L1)-N-3)(2)(CH3COO)(2)] that connects two terminal [Cu(L-3)(mu(L1)-N-3)] units through end-on azido; phenoxo oxygen and mu-CH3COO-1 kappa O center dot 2 kappa O' triple bridges to result in a tetranuclear unit Analyses of variable-temperature magnetic susceptibility data indicates that there is a global weak antiferromagnetic interaction between the copper(II) ions in complexes 1-3, with the exchange parameter J of -9 86, -11 6 and -19 98 cm(-1) for 1-3, respectively In complex 4 theoretical calculations show the presence of an antiferromagnetic coupling in the triple bridging ligands (acetato, phenoxo and azido) while the interaction through the double end-on azido bridging ligand is strongly ferromagnetic.

A unique example of structural and magnetic diversity in four interconvertible copper(II)−azide complexes with the same Schiff base ligand: a monomer, a dimer, a chain, and a layer

Four new Cu(II)-azido complexes of formula [CuL(N-3)] (1), [CuL(N-3)](2) (2), [Cu7L2(N-3)(12)](n) (3), and [Cu2L(dmen)-(N-3)(3)](n) (4) (dmen = N,N-dimethylethylenediamine) have been synthesized using the same tridentate Schiff base ligand HL (2-[1-(2-dimethylaminoethylimino)ethyl]phenol, the condensation product of dmen and 2-hydroxyacetophenone). The four compounds have been characterized by X-ray structural analyses and variable-temperature magnetic susceptibility measurements. Complex 1 is mononuclear, whereas 2 is a single mu-1,1 azido-bridged dinuclear compound. The polymeric compound 3 possesses a 2D structure in which the Cu(II) ions are linked by phenoxo oxygen atoms and two different azide bridges (mu-1,1 and mu-1,1,3). The structure of complex 4 is a double helix in which two mu-1,3-azido-bridged alternating one-dimensional helical chains of CuL(N-3) and Cu(dmen)(N-3)(2) are joined together by weak mu-1,1 azido bridges and H-bonds. The complexes interconvert in solution and can be obtained in pure form by carefully controlling the conditions. The magnetic properties of compounds 1 and 2 show the presence of very weak antiferromagnetic exchange interactions mediated by a ligand pi overlap (J = -1.77) and by an asymmetric 1,1-N-3 bridge (J = -1.97 cm(-1)), respectively. Compound 3 presents, from the magnetic point of view, a decorated chain structure with both ferro- and antiferromagnetic interactions. Compound 4 is an alternating helicoidal chain with two weak antiferromagnetic exchange interactions (J -1.35 and -2.64 cm(-1)).

Carbonyl compound dependent hydrolysis of mono-condensed Schiff bases: a trinuclear Schiff base complex and a mononuclear mixed-ligand ternary complex of copper(II)

Two Schiff bases, HL1 and HL2 have been prepared by the condensation of N-methyl-1,3-propanediamine (mpn) with salicylaldehyde and 1-benzoylacetone (Hbn) respectively. HL1 on reaction with Cu(ClO4)(2)center dot 6H(2)O in methanol produced a trinuclear Cu-II complex, [(CuL1)(3)(mu(3)-OH)](ClO4)(2)center dot H2O center dot 0.5CH(2)Cl(2) (1) but HL2 underwent hydrolysis under similar reaction conditions to result in a ternary Cu-II complex, [Cu(bn)(mpn)ClO4]. Both complexes have been characterised by single-crystal X-ray analyses, IR and UV-Vis spectroscopy and electrochemical studies. The partial cubane core [Cu3O4] of 1 consists of a central mu(3)-OH and three peripheral phenoxo bridges from the Schiff base. All three copper atoms of the trinuclear unit are five-coordinate with a distorted square-pyramidal geometry. The ternary complex 2 is mononuclear with the square-pyramidal Cu-II coordinated by a chelating bidentate diamine (mpn) and a benzoylacetonate (bn) moiety in the equatorial plane and one of the oxygen atoms of perchlorate in an axial position. The results show that the Schiff base (HL2) derived from 1-benzoylacetone is more prone to hydrolysis than that from salicylaldehyde (HL1). Magnetic measurements of 1 have been performed in the 1.8-300 K temperature range. The experimental data clearly indicate antiferromagnetism in the complex. The best-fit parameters for complex 1 are g = 2.18(1) and J = -15.4(2) cm(-1).

Magnetic coupling in trinuclear partial cubane copper(II) complexes with a hydroxo bridging core and peripheral phenoxo bridges from NNO donor Schiff base ligands

Three new trinuclear copper(II) complexes, [(CuL1)(3)(mu(3)-OH)](ClO4)(2)center dot 3.75H(2)O (1), [(CuL2)(3)(mu(3)-OH)](ClO4)(2) (2) and [(CuL3)(3)(mu(3)-OH)](BF4)(2)center dot 0.5CH(3)CN (3) have been synthesized from three tridentate Schiff bases HL1, HL2, and HL3 (HL1 = 2-[(2-amino-ethylimino)-methyl]-phenol, HL2 = 2-[(2-methylamino-ethylimino)-methyl]-phenol and HL3 = 2-[1-(2-dimethylamino-ethylimino)-ethyl]-phenol). The complexes are characterized by single-crystal X-ray diffraction analyses, IR, UV-vis and EPR spectroscopy, and variable-temperature magnetic measurements. All the compounds contain a partial cubane [Cu3O4] core consisting of the trinuclear unit [(CuL)(3)(mu(3)-OH)](2+) together with perchlorate or fluoroborate anions. In each of the complexes, the three copper atoms are five-coordinated with a distorted square-pyramidal geometry except in complex 1, in which one of the Cu-II ions of the trinuclear unit is six-coordinate being in addition weakly coordinated to one of the perchlorate anions. Variable-temperature magnetic measurements and EPR spectra indicate an antiferromagnetic exchange coupling between the CuII ions of complexes 1 and 2, while this turned out to be ferromagnetic for complex 3. Experimental values have been fitted according to an isotropic exchange Hamiltonian. Calculations based on Density Functional Theory have also been performed in order to estimate the exchange coupling constants in these three complexes. Both sets of values indicate similar trends and specially calculated J values establish a magneto-structural correlation between them and the Cu-O-Cu bond angle, in that the coupling is more ferromagnetic for smaller bond angle values.

Nickel(II) and copper(II) complexes of Schiff base ligands containing N4O2 and N4S2 donors with pyrrole terminal binding groups: synthesis, characterization, X-ray structures, DFT and electrochemical studies

A series of hexadentate ligands, H2Lm (m = 1−4), [1H-pyrrol-2-ylmethylene]{2-[2-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)ethoxy]phenyl}amine (H2L1), [1H-pyrrol-2-ylmethylene]{2-[4-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)butoxy]phenyl}amine (H2L2), [1H-pyrrol-2-ylmethylene][2-({2-[(2-{[1H-pyrrol-2-ylmethylene]amino}phenyl)thio]ethyl}thio)phenyl]amine (H2L3) and [1H-pyrrol-2-ylmethylene][2-({4-[(2-{[1H-pyrrol-2-lmethylene]amino}phenyl)thio]butyl}thio) phenyl]amine (H2L4) were prepared by condensation reaction of pyrrol-2-carboxaldehyde with {2-[2-(2-aminophenoxy)ethoxy]phenyl}amine, {2-[4-(2-aminophenoxy)butoxy]phenyl}amine, [2-({2-[(2-aminophenyl)thio]ethyl}thio)phenyl]amine and [2-({4-[(2-aminophenyl)thio]butyl}thio)phenyl]amine respectively. Reaction of these ligands with nickel(II) and copper(II) acetate gave complexes of the form MLm (m = 1−4), and the synthesized ligands and their complexes have been characterized by a variety of physico-chemical techniques. The solid and solution states investigations show that the complexes are neutral. The molecular structures of NiL3 and CuL2, which have been determined by single crystal X-ray diffraction, indicate that the NiL3 complex has a distorted octahedral coordination environment around the metal while the CuL2 complex has a seesaw coordination geometry. DFT calculations were used to analyse the electronic structure and simulation of the electronic absorption spectrum of the CuL2 complex using TDDFT gives results that are consistent with the measured spectroscopic behavior of the complex. Cyclic voltammetry indicates that all copper complexes are electrochemically inactive but the nickel complexes with softer thioethers are more easily oxidized than their oxygen analogs.

Conformational studies of mixed-ligand copper(II) chelates. Crystal and molecular structure of (N,N-dimethyl-N′-ethyl-1,2-diaminoethane-(1-phenyl-1,3,-butanedionato)copper(II) perchlorate

The IR and ligand field spectra and the structure of the mixed-ligand compound [N,N-dimethyl-N′-ethyl-1,2-diaminoethane(1-phenyl-1,3-butanedionato)(perchlorato)copper(II)]), [Cu(dmeen)bzac(OClO3)], are reported. The structure was determined by single crystal X-ray diffraction analysis (triclinic, space group ). The structure is square pyramidal with the apical position occupied by one oxygen of the tetrahedral perchlorato group (distance from copper 2.452(5) Å). The plane of the phenyl ring is tilted forming an angle of 16.72(14)° with the plane of the β-dionato moiety. The nitrogenous base adopts the gauche conformation with torsional angle of 108.72(14)°. The ethyl group is cis oriented relative to the phenyl group, occupying the equatorial position with the vector of the carbon-nitrogen bond forming an angle of 143.9(3)° with the CuNN plane. The interactions of the adjacent axial hydrogen with an oxygen of the perchlorato group result in hydrogen bond formation. The IR spectra reveal that in the solid state the Br− or Cl− displace easily the ClO4− group. The shifts in the ligand field spectra indicate that polar solvents participate in donor-acceptor interactions with the metal centre along an axis perpendicular to the CuN2O2 plane.

Synthesis and X-ray crystal structure of the copper(I) dicarboxylic acid complex [Cu(η1-bdoaH)(PPh3)3] (bdoaH2 = benzene-1,2- dioxyacetic acid)

The copper(II) complex [Cu(bdoa)(H2O)2] (bdoaH2 = benzene-1,2-dioxyacetic acid) reacts with triphenylphosphine (1:4 mol ratio) to give the colourless copper(I) complex [Cu(η1-bdoaH)(PPh3)3] (1) in good yield. The X-ray crystal structure of the complex shows the copper atom at the centre of a distorted tetrahedron, and is ligated by the phosphorus atoms of the three triphenylphosphines and one carboxylate oxygen atom of the bdoaH− ligand. Significant intermolecular hydrogen-bonding exists between the pendant carboxylate OH function of one molecule and the uncoordinated “ketonic” oxygen of a neighbouring molecule. Complex 1 is non-conducting in chloroform but ionizes readily in acetonitrile. The cyclic voltammogram of an acetonitrile solution of 1 shows a single irreversible anodic peak for the oxidation of the PPh3 ligands and the copper(I) centre, and a single irreversible cathodic peak for the reduction of the bdoaH− ion. IR and mass spectral data for 1 are given.

Copper(II) complexes of benzene-1,2-dioxyacetic acid (bdoaH2): X-ray crystal structure of [Cu2(bdoa)(phen)4]bdoa·13H2O (phen = 1,10-phenanthroline)

Copper(II) acetate reacts with benzene-1,2-dioxyacetic acid (bdoaH2) in aqueous media to give [Cu(bdoa)(H2O)2] (1). Complex 1 reacts with the N-donor ligands pyridine (py), ammonia and 1,10-phenanthroline (phen) to give [Cu(bdoa)(NH3)2]·H2O (2), [Cu(bdoa)(py)2]·H2O (3) and [Cu2(bdoa)(phen)4]bdoa·13H2O (4), respectively. The X-ray crystal structure of the dicopper(II,II) complex 4 shows each copper atom at the centre of a distorted trigonal bipyramid comprising four nitrogen atoms from two chelating phen ligands and a single oxygen atom from one of the carboxylate moieties of the bridging bdoa2− ligand. The cyclic voltammogram of 4 shows a single reversible wave for the Cu2+/Cu+ couple at E = + 115 mV (vs Ag/AgCl). Spectroscopic and magnetic data for the complexes are given.

Insertion of a hydroxido bridge into a diphenoxido dinuclear copper(II) complex: drastic change of the magnetic property from strong antiferromagnetic to ferromagnetic and enhancement in the catecholase activity

A diphenoxido-bridged dinuclear copper(II) complex, [Cu2L2(ClO4)(2)] (1), has been synthesized using a tridentate reduced Schiff base ligand, 2-[[2-(diethylamino)-ethylamino]methyl]phenol (HL). The addition of triethylamine to the methanolic solution of this complex produced a novel triple bridged (double phenoxido and single hydroxido) dinuclear copper(II) complex, [Cu2L2(OH)]ClO4 (2). Both complexes 1 and 2 were characterized by X-ray structural analyses, variable-temperature magnetic susceptibility measurements, and spectroscopic methods. In 1, the two phenoxido bridges are equatorial-equatorial and the species shows strong antiferromagnetic coupling with J = -615.6(6.1) cm(-1). The inclusion of the equatorial-equatorial hydroxido bridge in 2 changes the Cu center dot center dot center dot Cu distance from 3.018 angstrom (avg.) to 2.798 angstrom (avg.), the positions of the phenoxido bridges to axial-equatorial, and the magnetic coupling to ferromagnetic with J = 50.1(1.4) cm(-1). Using 3,5-di-tert-butylcatechol as the substrate, the catecholase activity of the complexes has been studied in a methanol solution; compound 2 shows higher catecholase activity (k(cat) = 233.4 h(-1)) than compound 1 (k(cat) = 93.6 h(-1)). Both complexes generate identical species in solution, and they are interconvertible simply by changing the pH of their solutions. The higher catecholase activity of 2 seems to be due to the presence of the OH group, which increases the pH of its solution.

A new tetranuclear copper(II) complex with oximate bridges: structure, magnetic properties and DFT study

A new tetranuclear complex, [Cu4L4](ClO4)4·2H2O (1), has been synthesized from the self-assembly of copper(II) perchlorate and the tridentate Schiff base ligand (2E,3E)-3-(2-aminopropylimino) butan-2-one oxime (HL). Single-crystal X-ray diffraction studies reveal that complex 1 consists of a Cu4(NO)4 core where the four copper(II) centers having square pyramidal environment are arranged in a distorted tetrahedral geometry. They are linked together by a rare bridging mode (μ3-η1,η2,η1) of oximato ligands. Analysis of magnetic susceptibility data indicates moderate antiferromagnetic (J1 = −48 cm−1, J2 = −40 cm−1 and J3 = −52 cm−1) exchange interaction through σ-superexchange pathways (in-plane bridging) of the oxime group. Theoretical calculations based on DFT technique have been used to obtain the energy states of different spin configurations and estimate the coupling constants and to understand the exact magnetic exchange pathways.