926 resultados para CELL STIMULATORY FACTOR


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Transcription factor NF-E2 activity is thought to be crucial for the transcriptional regulation of many erythroid-specific genes. The three small Maf family proteins (MafF, MafG, and MafK) that are closely related to the c-Maf protooncoprotein constitute half of the NF-E2 activity by forming heterodimers with the large tissue-restricted subunit of NF-E2 called p45. We have established and characterized murine erythroleukemia cells that conditionally overexpress MafK from a metallothionein promoter. The conditional expression of MafK caused accumulation of hemoglobin, an indication of terminal differentiation along the erythroid pathway. Concomitantly, DNA binding activities containing MafK were induced within the MafK-overexpressing cells. These results demonstrate that MafK can promote the erythroid differentiation program in erythroleukemia cells and suggest that the small Maf family proteins are key regulatory molecules for erythroid differentiation.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

In cell culture, type alpha transforming growth factor (TGF-alpha) stimulates epithelial cell growth, whereas TGF-beta 1 overrides this stimulatory effect and is growth inhibitory. Transgenic mice that overexpress TGF-alpha under control of the mouse mammary tumor virus (MMTV) promoter/enhancer exhibit mammary ductal hyperplasia and stochastic development of mammary carcinomas, a process that can be accelerated by administration of the chemical carcinogen 7,12-dimethylbenz[a]anthracene. MMTV-TGF-beta 1 transgenic mice display mammary ductal hypoplasia and do not develop mammary tumors. We report that in crossbreeding experiments involving the production of mice carrying both the MMTV-TGF-beta 1 and MMTV-TGF-alpha transgenes, there is marked suppression of mammary tumor formation and that MMTV-TGF-beta 1 transgenic mice are resistant to 7,12-dimethylbenz[a]anthracene-induced mammary tumor formation. These data demonstrate that overexpression of TGF-beta 1 in vivo can markedly suppress mammary tumor development.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Regenerative proliferation occurs in the inner-ear sensory epithelial of warm-blooded vertebrates after insult. To determine how this proliferation is controlled in the mature mammalian inner ear, several growth factors were tested for effects on progenitor-cell division in cultured mouse vestibular sensory epithelia. Cell proliferation was induced in the sensory epithelium by transforming growth factor alpha (TGF-alpha) in a dose-dependent manner. Proliferation was also induced by epidermal growth factor (EGF) when supplemented with insulin, but not EGF alone. These observations suggest that stimulation of the EGF receptors by TGF-alpha binding, or EGF (plus insulin) binding, stimulates cell proliferation in the mature mammalian vestibular sensory epithelium.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Systemic infection activates the hypothalamic-pituitary-adrenal (HPA) axis, and brainstem catecholamine cells have been shown to contribute to this response. However, recent work also suggests an important role for the central amygdala (CeA). Because direct connections between the CeA and the hypothalamic apex of the HPA axis are minimal, the present study investigated whether the bed nucleus of the stria terminalis (BNST) might act as a relay between them. This was done by using an animal model of acute systemic infection involving intravascular delivery of the proinflammatory cytokine interleukin-1 (IL-1, 1 g/kg). Unilateral ibotenic acid lesions encompassing the ventral BNST significantly reduced both IL-1-induced increases in Fos immunoreactivity in corticotropin-releasing factor (CRF) cells of the hypothalamic paraventricular nucleus (PVN) and corresponding increases in adrenocorticotropic hormone (ACTH) secretion. Similar lesions had no effect on CRF cell responses to physical restraint, suggesting that the effects of BNST lesions were not due to a nonspecific effect on stress responses. In further studies, we examined the functional connections between PVN, BNST, and CeA by combining retrograde tracing with mapping of IL-1-induced increases in Fos in BNST and CeA cells. In the case of the BNST, these studies showed that systemic IL-1 administration recruits ventral BNST cells that project directly to the PVN. In the case of the CeA, the results obtained were consistent with an arrangement whereby lateral CeA cells recruited by systemic IL-1 could regulate the activity of medial CeA cells projecting directly to the BNST. In conclusion, the present findings are consistent with the hypothesis that the BNST acts as a relay between the CeA and PVN, thereby contributing to CeA modulation of hypophysiotropic CRF cell responses to systemic administration of IL-1.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The role of growth hormone (GH) in embryonic growth is controversial, yet preimplantation embryos express GH, insulin-like growth factor I (IGF-I) and their receptors. In this study, addition of bovine GH doubled the proportion of two-cell embryos forming blastocysts and increased by about 25% the number of cells in those blastocysts with a concentration-response curve showing maximal activity at 1 pg bovine GH ml(-1), with decreasing activity at higher and lower concentrations. GH increased the number of cells in the trophectoderm by 25%, but did not affect the inner cell mass of blastocysts. Inhibition of cell proliferation by anti-GH antiserum indicated that GH is a potent autocrine or paracrine regulator of the number of trophectoderm cells in vivo. Type 1 IGF receptors (IGF1R) were localized to cytoplasmic vesicles and plasma membrane in the apical domains of uncompacted and compacted eight-cell embryos, but were predominantly apparent in cytoplasmic vesicles of the trophectoderm cells of the blastocyst, similar to GH receptors. Studies using alphaIR3 antiserum which blocks ligand activation of IGF1R, showed that IGF1R participate in the autocrine or paracrine regulation of the number of cells in the inner cell mass by an endogenous IGF-I-IGF1R pathway. However, alphaIR3 did not affect GH stimulation of the number of trophectoderm cells. Therefore, CH does not use secondary actions via embryonic IGF-I to modify the number of blastocyst cells. This result indicates that GH and IGF-I act independently. GH may selectively regulate the number of trophectoderm cells and thus implantation and placental growth. Embryonic GH may act in concert with IGF-I, which stimulates proliferation in the inner cell mass, to optimize blastocyst development.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The granulocyte colony-stimulating factor (G-CSF) and Fit-3 receptor agonist progenipoietin-1 (ProGP-1) has potent effects on dendritic cell (DC) expansion and may be an alternative to G-CSF for the mobilization of stem cells for allogeneic stem cell transplantation (SCT). We studied the ability of stem cell grafts mobilized with this agent to induce graft-versus-host disease (GVHD) to minor and major histocompatibility antigens in the well-described B6 --> B6D2F1 SCT model. ProGP-1, G-CSIF, or control diluent was administered to donor B6 mice. ProGP-1 expanded all cell lineages in the spleen, and unseparated splenocytes from these animals produced large amounts of interleukin 10 (IL-10) and transforming growth factor beta (TGFbeta) whereas the expression of T-cell adhesion molecules was diminished. Transplantation survival was 0%, 50%, and 90% in recipients of control-, G-CSF-, and ProGP-1-treated allogeneic donor splenocytes, respectively (P < .0001). Donor pretreatment with ProGP-1 allowed a 4-fold escalation in T-cell dose over that possible with G-CSF. Donor CD4 T cells from allogeneic SCT recipients of ProGP-1 splenocytes demonstrated an anergic response to host antigen, and cytokine production (interferon gamma [IFNγ], IL-4, and IL-10) was also reduced while CD8 T-cell cytotoxicity to host antigens remained intact. Neither CD11c(hi) DCs nor CD11c(dim)/B220(hi) DCs from ProGP-1-treated animals conferred protection from GVHD when added to control spleen. Conversely, when equal numbers of purified T cells from control-, G-CSF-, or ProGP-1-treated allogeneic donors were added to allogeneic T-cell-depleted control spleen, survival at day 60 was 0%, 15%, and 90%, respectively (P < .0001). The improved survival in recipients of ProGP-1 T cells was associated with reductions in systemic tumor necrosis factor alpha generation and GVHD of the gastrointestinal tract. We conclude that donor pretreatment with ProGP-1 is superior to G-CSIF for the prevention of GVHD after allogeneic SCT, primarily due to incremental affects on T-cell phenotype and function

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The use of granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood as a source of stem cells has resulted in a high incidence of severe chronic graft-versus-host disease (cGVHD), which compromises the outcome of clinical allogeneic stem cell transplantation. We have studied the effect of G-CSF on both immune complex and fibrotic cGVHD directed to major (DBA/2 --> B6D2F1) or minor (B10.D2 --> BALB/c) histocompatibility antigens. In both models, donor pretreatment with G-CSF reduced cGVHD mortality in association with type 2 differentiation. However, after escalation of the donor T-cell dose, scleroderma occurred in 90% of the recipients of grafts from G-CSF-treated donors. In contrast, only 11% of the recipients of control grafts developed scleroderma, and the severity of hepatic cGVHD was also reduced. Mixing studies confirmed that in the presence of high donor T-cell doses, the severity of scleroderma was determined by the non-T-cell fraction of grafts from G-CSF-treated donors. These data confirm that the induction of cGVHD after donor treatment with G-CSF is dependent on the transfer of large numbers of donor T cells in conjunction with a putatively expanded myeloid lineage, providing a further rationale for the limitation of cell dose in allogeneic stem cell transplantation. (C) 2004 American Society for Blood and Marrow Transplantation.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The role of the eukaryotic release factor 1 (eRF1) in translation termination has previously been established in yeast; however, only limited characterization has been performed on any plant homologs. Here, we demonstrate that cosuppression of eRF1-1 in Arabidopsis (Arabidopsis thaliana) has a profound effect on plant morphology, resulting in what we term the broomhead phenotype. These plants primarily exhibit a reduction in internode elongation causing the formation of a broomhead-like cluster of malformed siliques at the top of the inflorescence stem. Histological analysis of broomhead stems revealed that cells are reduced in height and display ectopic lignification of the phloem cap cells, some phloem sieve cells, and regions of the fascicular cambium, as well as enhanced lignification of the interfascicular fibers. We also show that cell division in the fascicular cambial regions is altered, with the majority of vascular bundles containing cambial cells that are disorganized and possess enlarged nuclei. This is the first attempt at functional characterization of a release factor in vivo in plants and demonstrates the importance of eRF1-1 function in Arabidopsis.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The nuclear localization of a number of growth factors, cytokine ligands and their receptors has been reported in various cell lines and tissues. These include members of the fibroblast growth factor (FGF), epidermal growth factor and growth hormone families. Accordingly, a number of nuclear functions have begun to emerge for these protein families. The demonstration of functional interactions of these proteins with the nuclear import machinery has further supported their functions as nuclear signal transducers. Here, we review the membrane- trafficking machinery and pathways demonstrated to regulate this cell surface to nucleus-trafficking event and highlight the many remaining unanswered questions. We focus on the FGF family, which is providing many of the clues as to the process of this unusual phenomenon.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The activation of phosphoinositide 3-hydroxykinase (P13K) is currently believed to represent the critical regulatory event which leads to the production of a novel intracellular signal. We have examined the control of this pathway by a number of cell-surface receptors in NG115-401L-C3 neuronal cells. Insulin-like growth factor-I stimulated the accumulation of 3-phosphorylated inositol lipids in intact cells and the appearance of P13K in antiphosphotyrosine-antibody-directed immunoprecipitates prepared from lysed cells, suggesting that P13K had been activated by a mechanism involving a protein tyrosine kinase. In contrast, P13K in these cells was not regulated by a variety of G-protein-coupled receptors, nerve growth factor acting via a low affinity receptor, or receptors for transforming growth factor-beta and interleukin-1. The receptor-specificity of P13K activation in these cells places significant constraints on the possible physiological function(s) of this pathway.