1000 resultados para .Estudo qualitativo
Resumo:
The sportive television spectacle shows up like a media phenomenon which evidence performances and techniques that further on the community realized in the quotidian sportive practices into a show and play mixer, that more and more, sensibility the viewers. In this scenery , this research is about the relation between sportive television spectacle and viewer by the aesthetics perspective, and discussed the sport in the Physical Education context with the focus in the contributions to teaching in the school. The research, to the methodological view, uses the discuss analysis and realizes a qualitative study in two interdependent moments. In the first, analysis the dada collated in the Education, sport and television workshop. In the second, turns about TV images of sportive television spectacle to appreciated, to support a discuss of these phenomenon s aesthetics elements, looking for the relation established between the sportive television spectacle and viewer. The analysis s emphasis is in the sensations by sportive television spectacle, as well in the aesthetic elements problems promoted by this experience, from the two basics concepts, to know: the aesthetic and the synaesthetic perception. The analysis s corpus is composed by Esporte Espetacular TV program. Identify, in the sportive television spectacle appreciation, four big discuss axis of great importance between sportive television spectacle and viewer understanding: the relation space and time, the belonging feeling, the language interlacing, and beauty models. Understand in the analysis that, in the sportive TV scenery, occurs a construction image that seduces and involves the viewer through the aesthetics elements. From that discuss axis reflect about teaching sport in the school, main concern to the materialization a sport model only. Aims unfolding about space and time construction yet, and about the multiplicity language for to work in the school. Positions that no absolute rules, but that check the TV sport by the seduction promoted in the viewers through the aesthetics elements transmit
Resumo:
The accompanying the growth and development of the child is the guiding line of basic health measures directed at this public, acting within the scope of health monitoring and inferring positively in the rate of infant morbidity and mortality, which are still a preoccupation worldwide and in Brazil. However, mostly, this practice is based on the biomedical model of care, individualized, with emphasis on the medicalization and complaints, favoring the passivity of users. Given this issue, aim to develop accompanying the growth and development of the child in a Basic Unit Family Health, through a collective approach of medical care next to a health team, especially nurses and caregivers. This is a qualitative study, with the research-action method. Involved the four nurses and twenty-six of children's caregivers of the area of Basic Unit Family Health of Cidade Nova, in Natal, in the period from February to July 2010. The results were analyzed following the direction of the thematic analysis of Freire. In the situation analysis of the current reality of the accompanying the growth and development the children in the Basic Unit Family Health, through participant observation and applying a questionnaire to the nurses, we realize that despite these professionals have a knowledge tied to the paradigm of health promotion, in practice the monitoring of child is done through individual consultations in outpatient room, based on complaints brought by caregivers, with little solvability in actions employed. Given the need for change in medical care model, we decided jointly, in the focal group, for the collective monitoring of children's the growth and development, featuring then this proposal to the multidisciplinary team, discussing the participation of professional categories and planned collectively the actions. In the implementation stage of collective action, we contemplate the execution by the caregivers of anamnesis and physical examination, recording data in the Child Health Handbook and discussion of clinical findings, under the supervision of nurses and facilitators. In the evaluation, we found that this collective accompanying strategy allowed to caregivers learn new knowledge, exchange experiences, assistance in home care, beyond reduce the waiting time for medical care and creating opportunity of more time for debate about the children‟s health situation, differing of ambulatory care. As difficulties, we face with a high rate of defaulters (53.8%), lack of motivation and passivity of the users, little participation of other health professionals and nurses' involvement in other activities, technical and bureaucratic in the moment of care. Thus, we note also a strong rooting of individual clinical model on the way of thinking and acting of nurses and caregivers
Resumo:
The objective of analyze the shift of the working process of the ESF team in care of children with disabilities, from awareness-raising actions. It is a qualitative study, with the action-research method. Thirteen health professionals were involved from two teams of ESF unit area of the Unidade de Saúde da Família Dr. Chico Porto (UBSFCP) in Mossoró, from March to August 2011. Data were analyzed following the direction of freirean s thematic analysis. In the situational diagnosis of the current reality of CwD assistance in that UBSFCP, through participant observation and application of semi-structured interviews with professionals, we realize that despite these actions carry some assistance to the CwD, in practice few are used for inclusion and accessibility. The monitoring of the CwD is done through individual consultations by each team professional, home visits when possible, both ruled on the complaints and problems, with little solving in the used actions. Since the need for a change in the treatment model and training requirements as pointed out by professionals in the interview, then we decided to build the proposed of training suggested by the multidisciplinary team and put together collectively the achievement of this moment in all its phases. In the step of implementation (action), aspects related to the current situation in Brazil and Mossoró (Laws, policies and health care) for the CwD and CwD Assistance and their family in the ESF in the first two moments of the first training (action) were contemplate. On the second day we discussed the specialized care to CwD, contribution of the Handicapped Parents and Friends Association of Mossoró and in a second moment a workshop was held in which awareness for inclusion of CwD and actions of ESF were discussed. All these moments were discussed and collectively constructed. In the evaluation, we found that implementation (action) allowed to the professional the comprehension of new understandings about people with disabilities, on ways to include, guiding, caring, watching, and mainly to have a new vision on health assistance of the CwD, expanding assistance beyond clinical aspects and recognizing the educational aspects of the rights and duties of citizens and the inclusion of these children in the social spaces area. As difficulties, we face the need for some professionals to be absent to attend another job, solve personal problems, and little or no participation. Thus, during this action-research, the subjects were able to realize the importance of carrying out their practice to the quality of life for him and to the one they care
Resumo:
This research had as its guiding question: what theoretical and structural milestone of graduation nursing curriculum of public universities in the State of Rio Grande do Norte? The objectives of this study were: Analyze theoretical and structural milestones of graduation nursing curriculum of public universities in the State of Rio Grande do Norte; Identify the theoretical milestone and training models that guide the structural milestones of nursing curriculum courses of public universities studied; Analyze the training concepts of curriculums from the voices of the coordinators of the courses. This is a qualitative study, analytical, with discussions of the documentary and empirical research. Ten teachers participated who act as coordinators of the graduation courses in nursing or academic advisors, in UFRNCentral Campus in Natal and Health Sciences College (Facisa), in Santa Cruz-and on UERN -Campus Caicó, Mossoró and Pau dos Ferros. The information collected by interview was analyzed by sociology or symbolic cartography of Boaventura de Sousa Santos. The research was approved by the Research Ethics Committee of the UERN by the CAAE: 03610912.7.0000.5294. All the participants signed the Free Consent and clarified Term The results and discussion were presented in four scientific articles. The first article, titled the Pedagogical projects in nursing analysis in the light of the symbolic cartography, features the use of cartographic method in the researches and in the study of nursing curriculums. In the article The Analysis of theoretical-philosophical, structural and referential milestones in nursing curriculums, these milestones are renowned in curriculums of UERN and UFRN. The main challenges faced in the implementation of supervised internship in nursing provide a reflection on the difficulties that the internship supervisors present, especially with the relationship between education/service and the articulation theory/practice. In the last article are discussed the changes in nursing training from the former student profile, who won a boost from the curricular changes proposed by the national curriculum guidelines. The study concluded, by the analysis of theoretical and structural milestones of nursing curriculum courses of public universities of Rio Grande do Norte, that there is an explicit intention to train nurses for the health system and a search on innovative teaching projects in accordance with the national curriculum guidelines for the area of nursing. The thesis defended in this investigation was that the curriculum of public institutions of higher education in nursing in the State of Rio Grande do Norte advanced from a training focusing on biologicist model, flexneriana guidelines, for teaching able to articulate the health with the social, political and cultural issues
Resumo:
This study aimed to describe nurses' actions in the strategy of Integrated Management of Childhood Illness in the city of Natal, Rio Grande do Norte. This is a qualitative study with descriptive approach. The universe consisted of nurses from the Family Health Strategy, totaling 16 participants. For the research project was submitted for approval by the Ethics Committee of the Universidade Federal do Rio Grande do Norte, obtaining Opinion No. 187/2012. Data were obtained in two ways: a questionnaire survey to profile the training of nurses and an interview guided by a structured interview. Interviews were treated in the light of analysis of thematic category Bardin. The results showed the central thematic study "Integrated Management of Childhood Illness in the context of nursing activities" category and three analyzes: "Understanding the Integrated Management of Childhood Illness", "Difficulties invibializam use IMCI "and" Working conditions for nurses in the Integrated Management of Childhood Illness. " It is observed that nurses consider the Integrated Management of Childhood Illness useful, effective and important to keep sick children within the logic curative. However disregard the character of health promotion and disease prevention thereof. It was found that the participants still hold the attendance of crinaças within the biomedical model and that these same professionals are subjected to increasingly precarious working conditions and unhealthy due to lack of human and material resources. It was found that the interviewees do not follow the protocols of strategy because of barriers related to prescription medications by nurses, the medical, the lack of incentives, training and supervision by the municipal health and the Regional Nursing Council
Resumo:
O cuidado à criança envolve a identificação e o atendimento às necessidades de modo a oferecer-lhe atenção como pessoa em contínuo processo de crescimento e desenvolvimento. Contudo, o cuidado oferecido à criança que convive em instituição escolar está permeado por conflitos que fragilizam a relação família-escola, não sendo estimulada a articulação desses atores no que refere ao cuidar da criança. Diante dessa problemática, objetivou-se analisar a construção de um pacto do cuidar entre mães e educadoras de crianças que frequentam um Centro Municipal de Educação Infantil. Trata-se de um estudo qualitativo, tendo como método a pesquisa-ação. Envolveu doze mães e oito educadoras de uma instituição de educação infantil de Cidade Nova, no município de Natal, no período de abril a novembro de 2013. Os dados foram coletados através de entrevista grupo focal, observação participante, seminários e diário de campo. Os resultados foram analisados seguindo o direcionamento da análise temática freireana. Na etapa do diagnóstico situacional, que investigou a realidade vivenciada pelas participantes do estudo, percebeu-se que as educadoras não se sentem preparadas para lidar com aspectos de saúde-doença da criança e recusam as ações de cuidado como desempenho de suas funções, interpretada como uma atitude que ultrapassa sua competência profissional. Os pais, por sua vez, apresentaram dificuldade de entendimento e clareza da sua função e relação com a instituição e executam as ações de saúde sem associá-lo à promoção e prevenção, além de realizarem com conhecimento empírico. Vista a necessidade de mudança das ações de saúde prestadas à criança, decidiu-se conjuntamente, através de uma roda de conversa, realizar capacitações sobre higiene e limpeza, medidas caseiras no cuidado à criança e primeiros socorros. Na etapa de implementação da ação coletiva as participantes consideraram as atividades úteis no cuidado prestado à criança e perceberam a importância do cuidado compartilhado para o desenvolvimento infantil. Com o desenvolvimento das capacitações, as participantes sentiram a necessidade de sistematizar as atividades prestadas à criança nos problemas de saúde e, para tanto, foram construídos, conjuntamente, protocolos e procedimentos operacionais padrão para a formalizar as ações. Na etapa de avaliação dos encontros, constatou-se que há expectativas positivas para a continuidade do cuidado em comunhão entre pais e educadores, pois foram construídas novas percepções em relação ao cuidado da criança. Percebeu-se mudança considerável nas mães assíduas ao estudo quanto ao cuidado e interesse, no entanto tornaram-se evidentes as fragilidades no processo de trabalho do CMEI, pois emergiram a dificuldade existente nos membros que compõe a instituição de educação infantil de articular o cuidado à educação. Como principal dificuldade, elenca-se o alto índice de mães faltosas e a dificuldade de articular com outros profissionais de saúde para as atividades. Considera-se que o pacto de cuidar não foi implantado integralmente, pois partilhar cuidados sugere o encontro de pais e educadores que podem ter aspectos divergentes sobre necessidades infantis e desenvolvimento, o que requer constante negociação entre as partes. Nesse sentido, constitui-se em um processo contínuo de aperfeiçoamento entre família e instituição de educação infantil
Resumo:
Qualitative study on the meaning of a child s birth to the father. Its general purpose was to comprehend the significance the man attaches to his child s birth and its specific objectives were to identify the man s feelings with regard to his child s birth as well as to verify his attitude toward a child s birth. The study was founded on the theoretical reference system about the man in the gravid-puerperal cycle and the humanization of the assistance. The data were obtained through semistructured interview performed with men accompanying their children s birth whose wives were in the immediate puerperium. This stage occurred in two maternity hospitals in Natal-RN, both of which adopt the principle of safe notherhood in the attendance of women in the process of parturition. The material apprehended from the statements was treated in conformity with the content analysis method in the mode of thematic analysis according to Bardin. Three thematic categories emerged from this process: the father s attitude toward his child s birth, the father s feelings in respect of his child s birth, and the informations received by the father in the course of his child s birth. The speech content was analyzed in accordance with the principles of symbolic interactionism according to Blumer. The results showed that the husbands interact with their respective wives and respond with attitudes of care, help, support, and encouragement within the principles of humanization intermingled with feelings of happiness, restlessness, and suffering leading them to appraise and exalt their consorts. Besides, we verified that the father s attitudes and feelings in the delivery room in the light of symbolic interactionism tend to be influenced by the interaction between him and the attending professionals
Resumo:
The competitiveness of the trade generated by the higher availability of products with lower quality and cost promoted a new reality of industrial production with small clearances. Track deviations at the production are not discarded, uncertainties can statistically occur. The world consumer and the Brazilian one are supported by the consumer protection code, in lawsuits against the products poor quality. An automobile is composed of various systems and thousands of constituent parts, increasing the likelihood of failure. The dynamic and security systems are critical in relation to the consequences of possible failures. The investigation of the failure gives us the possibility of learning and contributing to various improvements. Our main purpose in this work is to develop a systematic, specific methodology by investigating the root cause of the flaw occurred on an axle end of the front suspension of an automobile, and to perform comparative data analyses between the fractured part and the project information. Our research was based on a flaw generated in an automotive suspension system involved in a mechanical judicial cause, resulting in property and personal damages. In the investigations concerning the analysis of mechanical flaws, knowledge on materials engineering plays a crucial role in the process, since it enables applying techniques for characterizing materials, relating the technical attributes required from a respective part with its structure of manufacturing material, thus providing a greater scientific contribution to the work. The specific methodology developed follows its own flowchart. In the early phase, the data in the records and information on the involved ones were collected. The following laboratory analyses were performed: macrography of the fracture, micrography with SEM (Scanning Electron Microscope) of the initial and final fracture, phase analysis with optical microscopy, Brinell hardness and Vickers microhardness analyses, quantitative and qualitative chemical analysis, by using X-ray fluorescence and optical spectroscopy for carbon analysis, qualitative study on the state of tension was done. Field data were also collected. In the analyses data of the values resulting from the fractured stock parts and the design values were compared. After the investigation, one concluded that: the developed methodology systematized the investigation and enabled crossing data, thus minimizing diagnostic error probability, the morphology of the fracture indicates failure by the fatigue mechanism in a geometrically propitious location, a tension hub, the part was subjected to low tensions by the sectional area of the final fracture, the manufacturing material of the fractured part has low ductility, the component fractured in an earlier moment than the one recommended by the manufacturer, the percentages of C, Si, Mn and Cr of the fractured part present values which differ from the design ones, the hardness value of the superior limit of the fractured part is higher than that of the design, and there is no manufacturing uniformity between stock and fractured part. The work will contribute to optimizing the guidance of the actions in a mechanical engineering judicial expertise
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
O presente artigo tem por objetivo discutir, a partir de um vértice histórico, a relação entre educação e psicanálise no Brasil. Partindo de um estudo qualitativo, fundamentado na análise bibliográfica relativa à produção psicanalítica dedicada à educação produzida no país nas primeiras décadas do século XX, são discutidas as contribuições da psicanálise na transformação das práticas educacionais. Os resultados indicam que a psicanálise esteve presente na educação de duas formas: inicialmente, pela divulgação de informações teóricas relativas aos conceitos psicanalíticos e às características do desenvolvimento emocional da criança, por intermédio de livros e cursos destinados a educadores, e, posteriormente, através da criação de uma prática de assistência ao escolar com problemas de aprendizagem ou comportamento, desenvolvida em clínicas de orientação infantil, que consistia na avaliação da criança e na orientação de pais e professores. Conclui-se que a psicanálise, enquanto fundamento teórico e prático, forneceu elementos que contribuíram para a sustentação dos pressupostos filosóficos da Escola Nova, que surgiu, a partir da década de 1920, como alternativa ao ensino tradicional.
Resumo:
This research has the goal to analyze the urban setting of the Planalto neighborhood, in Natal /RN, seeking to unravel the processes, agents and contradictions associated with the production of the space. The choice of neighborhood is justified by the observation that changes in its urban setting have been growing in speedy way. We highlight the performance of the housing market, in partnership with the state, and the construction of condominiums and buildings closed by the housing program Minha Casa, Minha Vida. This has favored the reproduction of a new " urban reality in the neighborhood, setting an urban standard that differs from the original morphology, seen as peripheral within the urban dynamics of the city. The research is a qualitative study, through documents, interviews with stakeholders, and photographic documentation. In this perspective , we seek to understand the current phase (2000s) the production of space in the neighborhood process through the development of the housing market , as an extension of the urban development in central zone of Natal/RN, analyzing the performance of agents and their producers the "new " uses redefining the "old ". Thus, it can be seen that there is in the neighborhood, urban reality in a pluralistic constitution, from the existence of different social classes inhabiting the same space. On this way, the city is produced from the appropriation of space by different social classes, although due to the economic condition of each of them
Resumo:
Lithium (Li) is a chemical element with atomic number 3 and it is among the lightest known elements in the universe. In general, the Lithium is found in the nature under the form of two stable isotopes, the 6Li and 7Li. This last one is the most dominant and responds for about 93% of the Li found in the Universe. Due to its fragileness this element is largely used in the astrophysics, especially in what refers to the understanding of the physical process that has occurred since the Big Bang going through the evolution of the galaxies and stars. In the primordial nucleosynthesis in the Big Bang moment (BBN), the theoretical calculation forecasts a Li production along with all the light elements such as Deuterium and Beryllium. To the Li the BNB theory reviews a primordial abundance of Log log ǫ(Li) =2.72 dex in a logarithmic scale related to the H. The abundance of Li found on the poor metal stars, or pop II stars type, is called as being the abundance of Li primordial and is the measure as being log ǫ(Li) =2.27 dex. In the ISM (Interstellar medium), that reflects the current value, the abundance of Lithium is log ǫ(Li) = 3.2 dex. This value has great importance for our comprehension on the chemical evolution of the galaxy. The process responsible for the increasing of the primordial value present in the Li is not clearly understood until nowadays. In fact there is a real contribution of Li from the giant stars of little mass and this contribution needs to be well streamed if we want to understand our galaxy. The main objection in this logical sequence is the appearing of some giant stars with little mass of G and K spectral types which atmosphere is highly enriched with Li. Such elevated values are exactly the opposite of what could happen with the typical abundance of giant low mass stars, where convective envelops pass through a mass deepening in which all the Li should be diluted and present abundances around log ǫ(Li) ∼1.4 dex following the model of stellar evolution. In the Literature three suggestions are found that try to reconcile the values of the abundance of Li theoretical and observed in these rich in Li giants, but any of them bring conclusive answers. In the present work, we propose a qualitative study of the evolutionary state of the rich in Li stars in the literature along with the recent discovery of the first star rich in Li observed by the Kepler Satellite. The main objective of this work is to promote a solid discussion about the evolutionary state based on the characteristic obtained from the seismic analysis of the object observed by Kepler. We used evolutionary traces and simulation done with the population synthesis code TRILEGAL intending to evaluate as precisely as possible the evolutionary state of the internal structure of these groups of stars. The results indicate a very short characteristic time when compared to the evolutionary scale related to the enrichment of these stars
Resumo:
Considering education a support to health promotion, care integration and citizenship formation,the purpose of this research was to analyze the perception of the oral surgeons from the Family Health Program of Natal-RN over education in health as well as their performance as educators based on their activities on the program. A qualitative study was accomplished by a semi-structured interview and a Free Association of Words Test with 80 oral surgeons from the Family Health Program of Natal-RN. The instruments were analyzed through the meaning analysis and the Central Nucleus of Vergès Theory. The results showed a lack of planning in health actions so there is no standardization on the educative practices done by the oral surgeons which mostly are focused on scholars. There was an agreement among the group according to the oral surgeons´ perception about education in health that education is related to its function of recall prevention ideas to the population. Most part of the context units analyzed by the professionals´ speech show the knowledge of education in health as an inadequate behavior change instrument of the individuals. An interesting point was a quotation cited by some professionals that included actual themes such as citizenship, motivation and life quality, put inside the speech of education in health. To the oral surgeons the biggest difficulties on the development of the educative actions are due to the lack of incentive by the Municipal Health Bureau and to the detachment and lack of valorization of the themes by the population. The oral surgeons consider themselves co-responsible for the formation of a population which is able to request its health. They also mention the knowledge about the need of the community participation on the planning of the Family Health Program actions. Finally, it is notable the need for more encouragement so the oral surgeons can be more capable and have more interest in applying education in health on the perspective of a new model in health, because once capable and stimulated they can awake the population to education importance as a great transformation instrument for people searching for a fair, equalitarian and citizeness society
Resumo:
The ludic therapy in a Phenomenological-Existential perspective is conceived as a psychotherapeutic process in which, the listening and talking, mediated by playing activities, allow the child to deal with their grief/suffering. This study is based on the need to broaden the understanding of this modality of clinical intervention by emphasizing the speech of the protagonists in the process: children in therapy. The objective was to understand the ludic therapy from the children s perspective, knowing the meanings assigned to the therapeutic process, to the psychologist and to the involvement of the children in clinical consultations. The main ideas that underlie this research are presented in three theoretical chapters covering, respectively, the suffering of children and the demand for psychotherapy, the Phenomenological-Existential clinical psychology, and the psychotherapy for children, in Brazil, under this theoretical-methodological approach. The study was qualitative, on a phenomenological basis, and included six children as participants, aged between six and ten years, undergoing ludic therapy for at least six months, and referred by their own therapists. In the research s corpus construction, individual meetings were held and mediated by tools to support expressiveness (ludic and pictures/figures boxes), added by the storytelling of an incomplete story about a child s visit to the therapy session, and the request for the elaboration of a message to be passed to a child who will go to see a psychologist. The analysis of the data was based on a variant of the phenomenological method proposed by Amedeo Giorgi. The results reveal a lack of knowledge by the children about the psychologist s activities. Thus, the children develop fantasies about this intervention modality because of lack of information. These observations are consistent with the historical meanings assigned to clinical psychology, involving ideas of normality and guilt. The meanings associated with the motives for a referral to a psychologist highlight the conflict "be a problem versus having a problem" and an elitist conception of clinical psychology. Children understand the characteristics of the therapeutic process, such as the specifics of the therapist-client relationship and the notion of freedom. They also demonstrate remarkable pleasure in the therapeutic process. Finally, it was concluded that the meanings attributed to the ludic therapy by the children are consistent with that proposed in the literature about the children s psychotherapy process in the Phenomenological-Existential perspective. Moreover, the relevance of both the children s experience in the therapeutic setting and the meanings of these proceedings understood by the children are highlighted by the listening to the protagonists in the ludic therapeutic process. The comprehension of these aspects and their transference from the clients experience to the reflective field, promote advances in the understanding of child psychotherapy and indicate the need for further studies with children using this approach.
Resumo:
O presente estudo tem como objetivo compreender os sentidos da experiência de jovens e adultos com a interação social virtual, partindo de suas narrativas. Inspiradas nas ideias de Martin Heidegger, especialmente em seu seminário A Questão da Técnica , refletiremos sobre os modos de ser-com, em tempos de tecnologia, internet, consumo e hipermodernidade, contexto deste estudo, onde as coisas são vivenciadas em seu extremo (hiperconsumo, hipercorpo, hipermercado, hipercartões). Neste cenário, a Internet e as Tecnologias de Informação e Comunicação estão mediando, cada vez mais o contato do homem com o mundo, reconfigurando a vida em sociedade. Diante disso, apresentamos A Era do Click , em que são possibilitados novos meios de estar com os outros. Este é um estudo qualitativo, baseado na fenomenologia de Heidegger, por ser favorecedora da compreensão dos sentidos da experiência em relação à questão problematizada. Como estratégias de pesquisa foram utilizadas sondagem de campo e entrevistas individuais, inspiradas nas narrativas de Walter Benjamin. Cinco colaboradores relataram suas experiências de ser-com no mundo virtual. A partir de seus relatos foi possível compreender que o espaço virtual se revela como mais um lócus, dentre tantos, no cotidiano do ser do homem, em que emergem diferentes modos de ser-com. Dependendo de sua abertura, a proximidade ou o distanciamento tornam-se relativos, do mesmo modo que o pessoal e o impessoal, o próprio e o impróprio. Além disso, tornou-se claro que, a virtualidade pode ajudar a lidar com a solidão e a angústia temporariamente, da mesma forma que pode tornar-se uma barreira para um contato mais aprofundado e autêntico com os outros. Os colaboradores demonstraram uma atitude de serenidade, um poder dizer sim e não simultaneamente à técnica moderna, além de uma postura de meditar sobre os modos como se conectam. Questionamos as implicações em longo prazo da virtualização do contato, estimulando novos estudos, sob a luz da fenomenologia heideggeriana