mRNA metabolism: nonsense mediated mRNA decay as a tool for gene therapy and the role of human DIS3L2 in transcript degradation

Tese de mestrado em Biologia Humana e Ambiente, apresentada à Universidade de Lisboa, através da Faculdade de Ciências, 2015

Human abdomen

An x-ray of the human abdomen

Galactic cosmic ray hazard in the unusual extended solar minimum between solar cycle 23 and 24

Galactic cosmic rays (GCRs) are extremely difficult to shield against and pose one of the most severe long-term hazards for human exploration of space. The recent solar minimum between solar cycles 23 and 24 shows a prolonged period of reduced solar activity and low interplanetary magnetic field strengths. As a result, the modulation of GCRs is very weak, and the fluxes of GCRs are near their highest levels in the last 25 years in the fall of 2009. Here we explore the dose rates of GCRs in the current prolonged solar minimum and make predictions for the Lunar Reconnaissance Orbiter (LRO) Cosmic Ray Telescope for the Effects of Radiation (CRaTER), which is now measuring GCRs in the lunar environment. Our results confirm the weak modulation of GCRs leading to the largest dose rates seen in the last 25 years over a prolonged period of little solar activity.

Statistical evaluation of alternative models of human evolution

An appropriate model of recent human evolution is not only important to understand our own history, but it is necessary to disentangle the effects of demography and selection on genome diversity. Although most genetic data support the view that our species originated recently in Africa, it is still unclear if it completely replaced former members of the Homo genus, or if some interbreeding occurred during its range expansion. Several scenarios of modern human evolution have been proposed on the basis of molecular and paleontological data, but their likelihood has never been statistically assessed. Using DNA data from 50 nuclear loci sequenced in African, Asian and Native American samples, we show here by extensive simulations that a simple African replacement model with exponential growth has a higher probability (78%) as compared with alternative multiregional evolution or assimilation scenarios. A Bayesian analysis of the data under this best supported model points to an origin of our species approximate to 141 thousand years ago (Kya), an exit out-of-Africa approximate to 51 Kya, and a recent colonization of the Americas approximate to 10.5 Kya. We also find that the African replacement model explains not only the shallow ancestry of mtDNA or Y-chromosomes but also the occurrence of deep lineages at some autosomal loci, which has been formerly interpreted as a sign of interbreeding with Homo erectus.

3D path planning with novel multiple 2D layered approach for complex human-robot interaction

Navigating cluttered indoor environments is a difficult problem in indoor service robotics. The Acroboter concept, a novel approach to indoor locomotion, represents unique opportunity to avoid obstacles in indoor environments by navigating the ceiling plane. This mode of locomotion requires the ability to accurately detect obstacles, and plan 3D trajectories through the environment. This paper presents the development of a resilient object tracking system, as well as a novel approach to generating 3D paths suitable for such robot configurations. Distributed human-machine interfacing allowing simulation previewing of actions is also considered in the developed system architecture.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Enhanced sensitivity to rapamycin following long-term oestrogen deprivation in MCF-7, T-47-D and ZR-75-1 human breast cancer cells

Human breast cancer cells (MCF-7, T-47-D and ZR-75-1) can adapt to circumvent any reduced growth rate during long-term oestrogen deprivation, and this provides three model systems to investigate mechanisms of endocrine resistance in breast cancer. In this paper we report consistent differences in the effects of three growth inhibitors following long-term oestrogen deprivation in all three cell models. Long-term oestrogen deprivation of MCF-7, T-47-D and ZR-75-1 cells resulted in reduced growth inhibition by PD98059 (2–10 µg/ml), implying a loss of dependence on mitogen-activated protein kinase pathways for growth. The growth inhibitor LY294002 (2–10 µM) inhibited growth of both oestrogen-maintained and oestrogen-deprived cells with similar dose–responses, implying continued similar dependence on phosphoinositide 3-kinase (PI3K) pathways with no alteration after adaptation to oestrogen independent growth. However, by contrast, long-term oestrogen deprivation resulted in an increased sensitivity to growth inhibition by rapamycin, which was not reduced by readdition of oestradiol. The enhanced inhibition of long-term oestrogen-deprived MCF-7-ED, T-47-D-ED and ZR-75-1-ED cell growth by combining rapamycin with LY294002 at concentrations where each alone had little effect, offers preclinical support to the development of therapeutic combinations of rapamycin analogues with other PI3K inhibitors in endocrine-resistant breast cancer.

Crosstalk with insulin and dependence on PI3K/Akt/mTOR rather than MAPK pathways in upregulation of basal growth following long-term oestrogen deprivation in three human breast cancer cell lines

Background: MCF-7, T-47-D, ZR-75-1 human breast cancer cell lines are dependent on oestrogen for growth but can adapt to grow during long-term oestrogen deprivation. This serves as a model for identification of therapeutic targets in endocrine-resistant breast cancer. Methods: An overlooked complication of this model is that it involves more than non-addition of oestrogen, and inadequate attention has been given to separating molecular events associated with each of the culture manipulations. Results: Insulin and oestradiol were shown to protect MCF-7 cells against upregulation of basal growth, demonstrating a crosstalk in the growth adaptation process. Increased phosphorylation of p44/42MAPK and c-Raf reflected removal of insulin from the medium and proliferation of all three cell lines was inhibited to a lesser extent by PD98059 and U0126 following long-term oestrogen/insulin withdrawal, demonstrating a reduced dependence on the MAPK pathway. By contrast, long-term oestrogen/insulin deprivation did not alter levels of phosphorylated Akt and did not alter the dose-response of growth inhibition with LY294002 in any of the three cell lines. The IGF1R inhibitor picropodophyllin inhibited growth of all MCF-7 cells but only in the long-term oestrogen/insulin-deprived cells was this paralleled by reduction in phosphorylated p70S6K, a downstream target of mTOR. Long-term oestrogen/insulin-deprived MCF-7 cells had higher levels of phosphorylated p70S6K and developed increased sensitivity to growth inhibition by rapamycin. Conclusions: The greater sensitivity to growth inhibition by rapamycin in all three cell lines following long-term oestrogen/insulin deprivation suggests rapamycin-based therapies might be more effective in breast cancers with acquired oestrogen resistance. Keywords Akt, breast cancer cells, endocrine resistance, insulin, MAPK, MCF-7 cells, mTOR, oestrogen, oestrogen-deprived, PI3K, picropodophyllin, rapamycin, T-47-D cells, ZR-75-1 cells

A single amino acid in the HA of pH1N1 2009 influenza virus affects cell tropism in human airway epithelium, but not transmission in ferrets

The first pandemic of the 21(st) century, pandemic H1N1 2009 (pH1N1 2009), emerged from a swine-origin source. Although human infections with swine-origin influenza have been reported previously, none went on to cause a pandemic or indeed any sustained human transmission. In previous pandemics, specific residues in the receptor binding site of the haemagglutinin (HA) protein of influenza have been associated with the ability of the virus to transmit between humans. In the present study we investigated the effect of residue 227 in HA on cell tropism and transmission of pH1N1 2009. In pH1N1 2009 and recent seasonal H1N1 viruses this residue is glutamic acid, whereas in swine influenza it is alanine. Using human airway epithelium, we show a differential cell tropism of pH1N1 2009 compared to pH1N1 2009 E227A and swine influenza suggesting this residue may alter the sialic acid conformer binding preference of the HA. Furthermore, both pH1N1 2009 E227A and swine influenza multi-cycle viral growth was found to be attenuated in comparison to pH1N1 2009 in human airway epithelium. However this altered tropism and viral growth in human airway epithelium did not abrogate respiratory droplet transmission of pH1N1 2009 E227A in ferrets. Thus, acquisition of E at residue 227 was not solely responsible for the ability of pH1N1 2009 to transmit between humans.

Study on indoor thermal environment and air quality of office rooms controlled by personal displacement ventilation using CFD

Three-dimensional computational simulations are performed to examine indoor environment and micro-environment around human bodies in an office in terms of thermal environment and air quality. In this study, personal displacement ventilation (PDV), including two cases with all seats taken and two middle seats taken, is compared with overall displacement ventilation (ODV) of all seats taken under the condition that supply temperature is 24℃ and air change rate is 60 l/s per workstation. When using PDV, temperature stratification, the characteristic of displacement ventilation, is obviously observed at the position of occupant’s head and clearer in the case with all seats taken. Verticalertical ertical temperature temperature temperature temperature temperature differences below height of the head areare under under under 2℃ in two cases in two cases in two cases in two cases in two cases in two cases in two cases in two cases with all seats taken，and the temperature with PDV is higher than that with ODV. Verticalertical ertical temperature temperature temperature temperature temperature temperature difference is under 3 under 3under 3 under 3℃ in the case in the case in the case in the case in the case in the case in the case with two middle seats taken. CO2 concentration is lower th is lower th is lower this lower this lower than 2 g/man 2 g/m an 2 g/man 2 g/man 2 g/man 2 g/m 3 in the breath zone. in the breath zone. in the breath zone. in the breath zone. in the breath zone. in the breath zone. in the breath zone. in the breath zone. in the breath zone. The results indicate that PDV can be used in the room with big change of occupants’ number to satisfy the need of thermal comfort and air quality. When not all seats are taken, designers should increase supply air requirement or reduce its temperature for thermal comfort. INDEX TERMS

Optimal beamforming in MIMO systems with HPA nonlinearity

In this paper, multiple-input multiple-output (MIMO) transmit beamforming (TB) systems under the consideration of nonlinear high-power amplifiers (HPAs) are investigated. The optimal beamforming scheme, with the optimal beamforming weight vector and combining vector, is proposed for MIMO systems with HPA nonlinearity. The performance of the proposed MIMO beamforming scheme in the presence of HPA nonlinearity is evaluated in terms of average symbol error probability (SEP), outage probability and system capacity, considering transmission over uncorrelated quasi-static frequency-flat Rayleigh fading channels. Numerical results are provided and show the effects of several system parameters, namely, parameters of nonlinear HPA, numbers of transmit and receive antennas, and modulation order of phase-shift keying (PSK), on performance.

Efficient animal-serum free 3D cultivation method for adult human neural crest-derived stem cell therapeutics

Due to their broad differentiation potential and their persistence into adulthood, human neural crest-derived stem cells (NCSCs) harbour great potential for autologous cellular therapies, which include the treatment of neurodegenerative diseases and replacement of complex tissues containing various cell types, as in the case of musculoskeletal injuries. The use of serum-free approaches often results in insufficient proliferation of stem cells and foetal calf serum implicates the use of xenogenic medium components. Thus, there is much need for alternative cultivation strategies. In this study we describe for the first time a novel, human blood plasma based semi-solid medium for cultivation of human NCSCs. We cultivated human neural crest-derived inferior turbinate stem cells (ITSCs) within a blood plasma matrix, where they revealed higher proliferation rates compared to a standard serum-free approach. Three-dimensionality of the matrix was investigated using helium ion microscopy. ITSCs grew within the matrix as revealed by laser scanning microscopy. Genetic stability and maintenance of stemness characteristics were assured in 3D cultivated ITSCs, as demonstrated by unchanged expression profile and the capability for self-renewal. ITSCs pre-cultivated in the 3D matrix differentiated efficiently into ectodermal and mesodermal cell types, particularly including osteogenic cell types. Furthermore, ITSCs cultivated as described here could be easily infected with lentiviruses directly in substrate for potential tracing or gene therapeutic approaches. Taken together, the use of human blood plasma as an additive for a completely defined medium points towards a personalisable and autologous cultivation of human neural crest-derived stem cells under clinical grade conditions.

Sole infection by human metapneumovirus among children with radiographically diagnosed community-acquired pneumonia in a tropical region

Background Limited information is available on the role of human metapneumovirus (HMPV) as the unique pathogen among children hospitalized for community-acquired pneumonia (CAP) in a tropical region. Objective We aimed to describe HMPV infection among children with CAP investigating bacterial and viral co-infections. Patients and methods A prospective study was carried out in Salvador, North-East Brazil. Overall, 268 children aged <5 years hospitalized for CAP were enrolled. Human metapneumovirus RNA was detected in nasopharyngeal aspirates (NPA) by reverse transcription polymerase chain reaction. Sixteen other bacterial and viral pathogens were investigated by an expanded panel of laboratory methods. Chest X-ray taken on admission was read by an independent paediatric radiologist unaware of clinical information or the established aetiology. Results Human metapneumovirus RNA was detected in NPAs of 11 (4.1%) children, of which 4 (36%) had sole HMPV infection. The disease was significantly shorter among patients with sole HMPV infection in comparison with patients with mixed infection (4 +/- 1 versus 7 +/- 2 days, P = 0.03). Three of those four patients had alveolar infiltrates. Conclusion Sole HMPV infection was detected in children with CAP in Salvador, North-East Brazil. HMPV may play a role in the childhood CAP burden.

p53 Mutant Human Glioma Cells Are Sensitive to UV-C-Induced Apoptosis Due to Impaired Cyclobutane Pyrimidine Dimer Removal

The p53 protein is a key regulator of cell responses to DNA damage, and it has been shown that It sensitizes glioma cells to the alkylating agent temozolomide by up-regulating the extrinsic apoptotic pathway, whereas it increases the resistance to chloroethylating agents, such as ACNU and BCNU, probably by enhancing the efficiency of DNA repair. However, because these agents induce a wide variety of distinct DNA lesions, the direct Importance of DNA repair is hard to access. Here, it is shown that the Induction of photoproducts by UV light (UV-C) significantly Induces apoptosis In a p53-mutated glioma background. This Is caused by a reduced level of photoproduct repair, resulting In the persistence of DNA lesions in p53-mutated glioma cells. UV-C-Induced apoptosis in p53 mutant glioma cells Is preceded by strong transcription and replication inhibition due to blockage by unrepaired photolesions. Moreover, the results Indicate that UV-C-induced apoptosis of p53 mutant glioma cells Is executed through the intrinsic apoptotic pathway, with Bcl-2 degradation and sustained Bax and Bak up-regulation. Collectively, the data Indicate that unrepaired DNA lesions Induce apoptosis In p53 mutant gliomas despite the resistance of these gliomas to temozolomide, suggesting that efficiency of treatment of p53 mutant gliomas might be higher with agents that Induce the formation of DNA lesions whose global genomic repair is dependent on p53. (Mol Cancer Res 2009;7(2):237-46)

Self-assembling of phenothiazine compounds investigated by small-angle X-ray scattering and electron paramagnetic resonance spectroscopy

Small-angle X-ray scattering (SAXS) and electron paramagnetic resonance (EPR) have been carried out to investigate the structure of the self-aggregates of two phenothiazine drugs, chlorpromazine (CPZ) and trifluoperazine (TFP), in aqueous solution. In the SAXS studies, drug solutions of 20 and 60 mM, at pH 4.0 and 7.0, were investigated and the best data fittings were achieved assuming several different particle form factors with a homogeneous electron density distribution in respect to the water environment. Because of the limitation of scattering intensity in the q range above 0.15 angstrom(-1), precise determination of the aggregate shape was not possible and all of the tested models for ellipsoids, cylinders, or parallelepipeds fitted the experimental data equally well. The SAXS data allows inferring, however, that CPZ molecules might self-assemble in a basis set of an orthorhombic cell, remaining as nanocrystallites in solution. Such nanocrystals are composed of a small number of unit cells (up to 10, in c-direction), with CPZ aggregation numbers of 60-80. EPR spectra of 5- and 16-doxyl stearic acids bound to the aggregates were analyzed through simulation, and the dynamic and magnetic parameters were obtained. The phenothiazine concentration in EPR experiments was in the range of 5-60 mM. Critical aggregation concentration of TFP is lower than that for CPZ, consistent with a higher hydrophobicity of TFP. At acidic pH 4.0 a significant residual motion of the nitroxide relative to the aggregate is observed, and the EPR spectra and corresponding parameters are similar to those reported for aqueous surfactant micelles. However, at pH 6.5 a significant motional restriction is observed, and the nitroxide rotational correlation times correlate very well with those estimated for the whole aggregated particle from SAXS data. This implies that the aggregate is densely packed at this pH and that the nitroxide is tightly bound to it producing a strongly immobilized EPR spectrum. Besides that, at pH 6.5 the differences in motional restriction observed between 5- and 16-DSA are small, which is different from that observed for aqueous surfactant micelles.