854 resultados para gaps in perception
Resumo:
Long air gaps containing a floating conductor are common insulation types in power grids. During the transmission line live-line work, the process of lineman entering the transmission line air gap constitutes a live-line work combined air gap, which is a typical long air gap containing a floating conductor. This thesis investigates the discharge characteristics, the discharge mechanism and a discharge simulation model of long air gaps containing a floating conductor in order to address the engineering issues in live-line work. The innovative achievements of the thesis are as follows: (1) The effect of the gap distance, the floating electrode structure, the switching impulse wavefront time, the altitude, and the deviation of the floating conductor from the axis on the breakdown voltage was determined. (2) The physical process of the discharges in long air gaps containing a floating conductor was determined. The reason why the discharge characteristics of long air gaps containing a floating electrode with complex geometrics and sharp protrusions and long air gaps with a rod-shaped floating electrode are similar has been studied. The formation mechanism of the lowest breakdown voltage area of a long air gap containing a floating conductor is explained. (3) A simulation discharge model of long air gaps containing a floating conductor was established, which can describe the physical process and predict the breakdown voltage. The model can realize the accurate prediction of the breakdown voltage of typical long air gaps containing a floating conductor and live-line work combined air gaps in transmission lines. The findings of the study can provide theoretical reference and technical support for improving the safety of live-line work.
Resumo:
Although the prominent role of neural oscillations in perception and cognition has been continuously investigated, some critical questions remain unanswered. My PhD thesis was aimed at addressing some of them. First, can we dissociate oscillatory underpinnings of perceptual accuracy and subjective awareness? Current work would strongly suggest that this dissociation can be drawn. While the fluctuations in alpha-amplitude decide perceptual bias and metacognitive abilities, the speed of alpha activity (i.e., alpha-frequency) dictates sensory sampling, shaping perceptual accuracy. Second, how are these oscillatory mechanisms integrated during attention? The obtained results indicate that a top-down visuospatial mechanism modulates neural assemblies in visual areas via oscillatory re-alignment and coherence in the alpha/beta range within the fronto-parietal brain network. These perceptual predictions are reflected in the retinotopically distributed posterior alpha-amplitude, while perceptual accuracy is explained by the higher alpha-frequency at the to-be-attended location. Finally, sensory input, elaborated via fast gamma oscillations, is linked to specific phases of this slower activity via oscillatory nesting, enabling integration of the feedback-modulated oscillatory activity with sensory information. Third, how can we relate this oscillatory activity to other neural markers of behaviour (i.e., event-related potentials)? The obtained results favour the oscillatory model of ERP genesis, where alpha-frequency shapes the latency of early evoked-potentials, namely P1, with both neural indices being related to perceptual accuracy. On the other hand, alpha-amplitude dictates the amplitude of later P3 evoked-response, whereas both indices shape subjective awareness. Crucially, by combining different methodological approaches, including neurostimulation (TMS) and neuroimaging (EEG), current work identified these oscillatory-behavior links as causal and not just as co-occurring events. Current work aimed at ameliorating the use of the TMS-EEG approach by explaining inter-individual differences in the stimulation outcomes, which could be proven crucial in the way we design entrainment experiments and interpret the results in both research and clinical settings.
Resumo:
The experiences induced by psychedelics share a wide variety of subjective features, related to the complex changes in perception and cognition induced by this class of drugs. A remarkable increase in introspection is at the core of these altered states of consciousness. Self-oriented mental activity has been consistently linked to the Default Mode Network (DMN), a set of brain regions more active during rest than during the execution of a goal-directed task. Here we used fMRI technique to inspect the DMN during the psychedelic state induced by Ayahuasca in ten experienced subjects. Ayahuasca is a potion traditionally used by Amazonian Amerindians composed by a mixture of compounds that increase monoaminergic transmission. In particular, we examined whether Ayahuasca changes the activity and connectivity of the DMN and the connection between the DMN and the task-positive network (TPN). Ayahuasca caused a significant decrease in activity through most parts of the DMN, including its most consistent hubs: the Posterior Cingulate Cortex (PCC)/Precuneus and the medial Prefrontal Cortex (mPFC). Functional connectivity within the PCC/Precuneus decreased after Ayahuasca intake. No significant change was observed in the DMN-TPN orthogonality. Altogether, our results support the notion that the altered state of consciousness induced by Ayahuasca, like those induced by psilocybin (another serotonergic psychedelic), meditation and sleep, is linked to the modulation of the activity and the connectivity of the DMN.
Resumo:
Reconhecer com precisão indivíduos com maior risco imediato de morte súbita cardíaca (MSC) ainda é uma questão em aberto. A natureza fortuita dos eventos cardiovasculares agudos não parece se adequar ao conhecido modelo de indução de taquicardia/fibrilação ventricular por um gatilho em sincronia a um substrato arritmogênico estático. Quanto ao mecanismo da MSC, uma instabilidade elétrica dinâmica explicaria melhor a raridade da associação simultânea de um gatilho certo a um substrato cardíaco apropriado. Diversos estudos tentaram medir essa instabilidade elétrica cardíaca (ou um equivalente válido) em uma sequência de batimentos cardíacos no ECG. Dentre os mecanismos possíveis podemos citar o prolongamento do QT, dispersão do QT, potenciais tardios, alternância de onda T ou T-wave alternans (TWA), e turbulência da frequência cardíaca. Este artigo se atém em particular ao papel da TWA no panorama atual da estratificação de risco cardíaco. Os achados sobre TWA ainda são heterogêneos, variando de um desempenho prognóstico muito bom até um quase nulo, dependendo da população clínica observada e protocolo clínico usado. Para preencher as atuais lacunas no conhecimento sobre TWA, profissionais médicos e pesquisadores devem explorar melhor as características técnicas das diversas tecnologias disponíveis para a avaliação de TWA e atentar ao fato de que os valores de TWA respondem a diversos outros fatores, além de medicamentos. Informações sobre mecanismos celulares e subcelulares da TWA estão fora do escopo deste artigo, mas são referenciados alguns dos principais trabalhos sobre este tópico, com o intuito de auxiliar no entendimento dos conceitos e fatos cobertos neste artigo.
Resumo:
INTRODUÇÃO: A Prótese Implantável de Condução Óssea (BAHA) consiste em uma excelente opção na reabilitação auditiva de pacientes com perda auditiva condutiva e mista uni ou bilateral, e sensorioneural unilateral. Tem sido uma alternativa vantajosa sobre os aparelhos de condução óssea convencionais e os aparelhos de amplificação sonora individuais (AASI) quando o uso dos mesmos fica impossibilitado pela presença de otite externa crônica de difícil controle clínico. OBJETIVO: Apresentar o primeiro caso de BAHA realizado no Brasil, após a autorização da ANVISA, para a reabilitação da perda auditiva mista com episódios de otite externa crônica. MÉTODO: Paciente do sexo feminino, 50 anos, com perda auditiva de grau moderado à direita e severo à esquerda, zumbido bilateral, decorrente de otosclerose, submetida a quatro cirurgias de estapedotomia e com impossibilidade de uso de AASI devido a otorreia e otalgia bilateral. A avaliação médica e audiológica indicaram o benefício do BAHA. Realizada a cirurgia e implantação do sistema BAHA, a paciente apresentou melhora significativa nos limiares audiométricos, na percepção e discriminação da fala, além de relatar extrema satisfação relacionada ao fator estético. COMENTÁRIOS FINAIS: O processo cirúrgico do BAHA é seguro, simples e rápido, proporcionando excelentes resultados audiológicos e alto grau de satisfação por parte dos pacientes.
Resumo:
Context. We study galaxy evolution and spatial patterns in the surroundings of a sample of 2dF groups. Aims. Our aim is to find evidence of galaxy evolution and clustering out to 10 times the virial radius of the groups and so redefine their properties according to the spatial patterns in the fields and relate them to galaxy evolution. Methods. Group members and interlopers were redefined after the identification of gaps in the redshift distribution. We then used exploratory spatial statistics based on the the second moment of the Ripley function to probe the anisotropy in the galaxy distribution around the groups. Results. We found an important anticorrelation between anisotropy around groups and the fraction of early-type galaxies in these fields. Our results illustrate how the dynamical state of galaxy groups can be ascertained by the systematic study of their neighborhoods. This is an important achievement, since the correct estimate of the extent to which galaxies are affected by the group environment and follow large-scale filamentary structure is relevant to understanding the process of galaxy clustering and evolution in the Universe.
Resumo:
Appropriate pain assessment is very important for managing chronic pain. Given the cultural differences in verbally expressing pain and in psychosocial problems, specific tools are needed. The goal of this study was to identify and validate Brazilian pain descriptors. A purposive sample of health professionals and chronic pain patients was recruited. Four studies were conducted using direct and indirect psychophysical methods: category estimation, magnitude estimation, and magnitude estimation and tine-length. Results showed the descriptors which best describe chronic pain in Brazilian culture and demonstrated that there is not a significant correlation between patients and health professionals and that the psychophysical scale of judgment of pain descriptors is valid, stable, and consistent. Results reinforced that the translations of word descriptors and research tools into another language may be inappropriate, owing to differences in perception and communication and the inadequacy of exact translations to reflect the intended meaning. Given the complexity of the chronic pain, personal suffering involved, and the need for accurate assessment of chronic pain using descriptors stemming from Brazilian culture and language, it is essential to investigate the most adequate words to describe chronic pain. Although it requires more refinement, the Brazilian chronic pain descriptors can be used further to develop a multidimensional pain assessment tool that is culturally sensitive. (C) 2009 by the American Society for Pain Management Nursing
Resumo:
Objective: A needs analysis was undertaken to determine the quality and effectiveness of mental health services to Indigenous consumers within a health district of Southern Queensland. The study focussed on identifying gaps in the service provision for Indigenous consumers. Tools and methodologies were developed to achieve this. Method: Data were collected through the distribution of questionnaires to the target populations: district health service staff and Indigenous consumers. Questionnaires were developed through consultation with the community and the Steering Committee in order to achieve culturally appropriate wording. Of prime importance was the adaptation of questionnaire language so it would be fully understood by Indigenous consumers. Both questionnaires were designed to provide a balanced perspective of current mental health service needs for Indigenous people within the mental health service. Results: Results suggest that existing mental health services do not adequately meet the needs of Indigenous people. Conclusions: Recommendations arising from this study indicate a need for better communication and genuine partnerships between the mental health service and Indigenous people that reflect respect of cultural heritage and recognises the importance of including Indigenous people in the design and management of mental health services. Attention to the recommendations from this study will help ensure a culturally appropriate and effective mental health service for Indigenous consumers.
Resumo:
A meeting was convened in Canberra, Australia, at the request of the Australian Drug Evaluation Committee (ADEC), on December 3-4, 1997 to discuss the role of population pharmacokinetics and pharmacodynamics in drug evaluation and development. The ADEC was particularly concerned about registration of drugs in the pediatric age group. The population approach could be used more often than is currently the case in pharmacokinetic and pharmacodynamic studies to provide valuable information for the safe and effective use of drugs in neonates, infants, and children. The meeting ultimately broadened to include discussion about other subgroups. The main conclusions of the meeting were: 1. The population approach, pharmacokinetic and pharmacodynamic analysis, is a valuable tool both for drug registration purposes and for optimal dosing of drugs in specific groups of patients, 2. Population pharmacokinetic and pharmacodynamic studies are able to fill in the gaps' in registration of drugs, for example, to provide information on optimal pediatric dosing. Such studies provide a basis for enhancing product information to improve rational prescribing, 3. Expertise is required to perform the population studies and expertise, with a clinical perspective, is also required to evaluate such studies if they are to be submitted as part of a drug registration dossier Such expertise is available in the Australasian region and is increasing. Centers of excellence with the appropriate expertise to advise and assist should be encouraged to develop and grow in the region, 4. The use of the population approach by the pharmaceutical industry needs to be encouraged to provide valuable information not obtainable by other techniques. The acceptance of population pharmacokinetic and pharmacodynamic analyses by regulatory agencies also needs to be encouraged, and 5. Development of the population approach to pharmacokinetics and pharmacodynamics is needed from a public health perspective to ensure that all available information is collected and used to improve the way drugs are used. This important endeavor needs funding and support at the local and international levels.
Resumo:
Case management models evolved as the mental health care system shifted hospital to community settings. The research evidence underscores the efficacy of certain case management models under 'ideal' conditions; what is less clear, is how these models perform in day to day clinical practice. Moreover, the economic perspective adopted by most studies is relatively narrow thus limiting a proper understanding of the costs and benefits of such models. This paper reviews recent work in the field and highlights gaps in both method and application as a focus for future work. Curr Opin Psychiatry 12:195-199, (C) 1999 Lippincott Williams & Wilkins.
The N-15 natural abundance (delta N-15) of ecosystem samples reflects measures of water availability
Resumo:
We assembled a globally-derived data set for site-averaged foliar delta(15)N, the delta(15)N of whole surface mineral soil and corresponding site factors (mean annual rainfall and temperature, latitude, altitude and soil pH). The delta(15)N of whole soil was related to all of the site variables (including foliar delta(15)N) except altitude and, when regressed on latitude and rainfall, provided the best model of these data, accounting for 49% of the variation in whole soil delta(15)N. As single linear regressions, site-averaged foliar delta(15)N was more strongly related to rainfall than was whole soil delta(15)N. A smaller data set showed similar, negative correlations between whole soil delta(15)N, site-averaged foliar delta(15)N and soil moisture variations during a single growing season. The negative correlation between water availability (measured here by rainfall and temperature) and soil or plant delta(15)N fails at the landscape scale, where wet spots are delta(15)N-enriched relative to their drier surroundings. Here we present global and seasonal data, postulate a proximate mechanism for the overall relationship between water availability and ecosystem delta(15)N and, newly, a mechanism accounting for the highly delta(15)N-depleted values found in the foliage and soils of many wet/cold ecosystems. These hypotheses are complemented by documentation of the present gaps in knowledge, suggesting lines of research which will provide new insights into terrestrial N-cycling. Our conclusions are consistent with those of Austin and Vitousek (1998) that foliar (and soil) delta(15)N appear to be related to the residence time of whole ecosystem N.
Resumo:
The Strength of Weak Parties The aim of this article is to fill some gaps in research on the Brazilian electoral arena. The current literature, by neglecting the study of party organization, ends up overlooking fundamental questions for understanding how the electoral process works. This study addressed two questions: How do Brazilian parties work? What is the impact of party organization on a party`s decision to launch or withhold a candidate in a given election? We intend to show that the parties have more life than many studies on our political system tend to show. This partisan life helps understand one of the central aspects of the electoral arena, that is, how pre-election coordination occurs.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Objective: The aim of this in vitro study was to analyze the effect of glass-ionomer cement as a liner on the dentin/resin adhesive interface of lateral walls of occlusal restorations after thermocycling. Materials and Methods: Occlusal cavities were prepared in 60 human molars, divided into six groups: no liner (1 and 4); glass-ionomer cement (GIC, Ketac Molar Easymix, 3M ESPE) (2 and 5); and resin-modified glass-ionomer cement (RMGIC, Vitrebond, 3M ESPE) (3 and 6). Resin composite (Filtek Z250, 3M ESPE) was placed after application of an adhesive system (Adper Single Bond 2, 3M ESPE) that was mixed with a fluorescent reagent (Rhodamine B) to allow confocal microscopy analysis. Specimens of groups 4, 5 and 6 were thermocycled (5 degrees C-55 degrees C) with a dwell time of 30 seconds for 5000 cycles. After this period, teeth were sectioned in approximately 0.8-mm slices. One slice of each tooth was randomly selected for confocal microscopy analysis. The other slices were sectioned into 0.8 nun x 0.8 mm beams, which were submitted to microtensile testing (MPa). Data were analyzed using two-way ANOVA and Tukey test (p < 0.05). Results: There was no detectedstatistical difference on bond strength among groups (alpha < 0.05). Confocal microscopy analysis showed a higher mean gap size in group 4(12.5 mu m) and a higher percentage of marginal gaps in the thermocycled groups. The RNIGIC liner groups showed the lowest percentage of marginal gaps. Conclusions: Lining with RMGIC resulted in less gap formation at the dentin/resin adhesive interface after artificial aging. RMGIC or GIC liners did not alter the microtensile bond strength of adhesive system/resin composite to dentin on the lateral walls of Class I restorations.
Resumo:
P>Aim To assess the push-out strength of Epiphany SE, Epiphany and Hybrid Root SEAL to the dentine walls of root canals. Methodology Sixty roots of canines were prepared and distributed to six groups (n = 10) according to the filling material: GI - Epiphany SE, GII - Epiphany primer and sealer, GIII - Epiphany primer, sealer and resinous solvent, GIV - Clearfil DC Bond and Epiphany sealer, GV - Clearfil, Epiphany sealer and solvent and GVI - Hybrid Root SEAL. Resilon cones were used in all groups. Roots were sectioned transversally to obtain three slices from each third. One slice was subjected to the push-out test (MPa), and results were analysed by anova and Tukey`s test (P < 0.05). The other two slices were prepared for scanning electron microscopy (SEM). Failure mode was also analysed. Results A statistically significant difference (P < 0.05) occurred between Hybrid Root SEAL (5.27 +/- 2.07) and the other materials, GI (0.40 +/- 0.23), GII (0.78 +/- 0.45), GIII (0.57 +/- 0.28), GIV (0.40 +/- 0.24) and GV (0.50 +/- 0.41), which did not differ significantly from each other (P > 0.05). Adhesive failures predominated in groups I, II, IV and V, whilst mixed and cohesive failures were the most frequent in groups III and VI, respectively. There were gaps in the adhesive interface of GI and GII, continuity areas of the filling material with dentine in GIV and GV and good adaptation of the interface of GVI. Conclusion Hybrid Root SEAL had greater push-out strength to root canal dentine than Epiphany SE and Epiphany. The use of primer, solvent and adhesive system did not influence the adhesion of Epiphany.