362 resultados para diluidor do sêmen
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Pós-graduação em Aquicultura - FCAV
Resumo:
Pós-graduação em Genética e Melhoramento Animal - FCAV
Resumo:
Pós-graduação em Biotecnologia Animal - FMVZ
Resumo:
Pós-graduação em Biotecnologia Animal - FMVZ
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Pós-graduação em Aquicultura - FCAV
Resumo:
Pós-graduação em Ciência e Tecnologia Animal - FEIS
Resumo:
The acceptance of biotechnology for the most equine breeders association had a significant effect in the horse industry, gaining popularity around the world, because the increasing on the genetic gain, allowing the use of sub fertile mares and stallions with high genetics value on reproduction. The embryos in vitro production of human and cattle has been used with success, however in vitro embryo production is not efficient in the horse, as oocyte transfer (OT) and intracytoplasmatic sperm injection (ICSI). The oocyte transfer has been used especially in subfertile old mares presenting reproductive pathologies as: endometrite, cervical and uterine adhesions, blocked oviduct, perineal laceration and ovulation failures. During oocyte recovery process, the oocytes must be collected from immature follicles that need be matured in vitro or in vivo matured oocytes from pre-ovulatory follicles through the transvaginal aspiration guided by ultrasound. The recovered oocyte is transferred to a previously inseminated recipient mare, through the flank laparotomy. The intracytoplasmatic sperm injection (ICSI) is a procedure of in vitro fertilization that needs only one sperm that is aspirated and injected inside the oocyte. The oocytes used, can be from mature and immature follicles. Fresh, cooled and frozen semen can be used, because the procedure not requires a functional sperm. The use of Piezo drill resulted in a breakthrough the pellucid zone, allowing the vibration per minute provided in the sperm injection pipette, a major result of cleaved oocytes, due to a better sperm injection in the oocyte. The embryo transfer can be straight inside the oviduct, as also transcervical transferred after embryo culture produced in vitro. In conclusion both procedures (OT and ICSI) are effective to be used on equine assisted reproduction, getting results even lower than expected, but satisfactory from animal genetically superior
Resumo:
Nowadays the regular practice of sports is known as a way to obtain a better quality of life. On the other hand, the media has been distorting this idea, determining the ideal body as the hypertrophy phenotype. It is well known that the genetic factor does not allow all individuals to have this body shape. Besides the fact that, the anxiety of these people in obtain quick results, as one of the globalization’s consequence, make use of anabolic steroid to achieve this goal. However the bodybuilding or the strength muscle gain, make anabolic steroids users abuse and in major cases the users do not know the side effects. In front of these considerations, the present study evaluated the effects of the treatment with anabolic steroids and/or high intensity physical training on the corporal developing, the reproductive organs, bone parameters (strength and bone deformation) and seminal parameters as well the social behavior (aggressiveness). In other to obtain the experimental group, male Wistar rats were used, with 75 days old. The groups were divided into: Vehicle Non-Training (NV), Anabolic Steroid-Non-Training (NA), Vehicle-Training (TV) and Anabolic Steroid-Training (TA). These rats received i.m. injections, twice a week, of anabolic steroid (5mg/kg per animal of nandrolona decanoate) or vehicle (the same volume of peanut oil per animal) and the group TV and TA were submitted to physical training three times per week, during eight weeks. The body mass, wet weight of reproductive organs, femur and semen of the different groups were measured. The aggressive test was also realized in two steps: the first, within 4 weeks of the treatment and the other step in the end of the treatment, in this period the animal was isolated. It was not observed alterations in body mass of the groups. Though it was observed a benefic effect on the maximum strength of the... (Complete abstract click electronic access below)
Resumo:
O estresse oxidativo é um dos fatores mais importantes na diminuição da qualidade do sêmen, pois leva a perda da integridade da membrana dos espermatozóides e de danos estruturais ao DNA através da cascata de lipoperoxidação. Os danos funcionais relacionados ao estresse oxidativo como a diminuição da motilidade e da viabilidade do espermatozóide são algumas das principais causas de infertilidade masculina. Ainda, os lipídios que compõe a membrana plasmática são macromoléculas que, além de estarem envolvidas em complexos sistemas biológicos e processos metabólicos da célula, são altamente susceptíveis ao processo de lipoperoxidação desencadeado pelo estresse oxidativo. Neste contexto, este projeto propôs o estudo das alterações no perfil lipídico do plasma seminal que pudessem estar relacionadas ao estresse oxidativo e posterior comparação destes perfis em busca de biomarcadores de infertilidade. Para isso, foram coletadas amostras de sêmen de 116 pacientes que procuraram o setor de Reprodução Humana da Universidade Federal de São Paulo. Estas amostras foram submetidas a técnica de TBARS para quantificação dos produtos finais do estresse oxidativo e separação dos grupos, e em seguida, ao protocolo de extração de lipídios para obtenção dos espectros de massa através da técnica de MALDI (Matrix Assisted Laser Disorption Ionization). Com esta análise foi possível a identificação de 31 lipídeos super representados nos diferentes grupos e que, futuramente, poderão vir a ser utilizados na avaliação da qualidade seminal
Resumo:
In the last years, the embryo in vitro production for every domestic species and mainly for bovine has attained a notorius status. This reproductive biotechnical procedure associate with ultrasound-guided ovum pick up (OPU) has been more and more incorporated and spread in our cattle herds, ranking up Brazil already at the top of the list in number of in vitro embryo produced. Some significant advantages provided, such as the possibility of using the premature or pregnant animals oocytes, without necessarily requiring the use of hormonal treatment, to make it possible to generate pregnancy at a shorter period of time, the rationalization in the use of semen and optimization in the use of sexed semen were determinant factors for OPU/IVP to reach this outstanding position. Nevertheless, right now the possibility of IVP embryo cryopreservation, just now is the biggest impediment for maximizing the use of this biotechnology, due to both lack of efficient methods and low laboratory produced embryo cryotolerance. Nowadays, the most used methods of IVP embryo cryopreservation are: slow freezing and vitrification. Traditionally, slow freezing is still the most used methods for in vivo and in vitro produced embryo cryopreservation. However, more recently vitrification - although still not commercially used in large scale - has been presenting satisfactory results in IVP embryo cryopreservation, according to searches
Resumo:
The success in implementing an embryo transfer program derives from many factors. The embryo recovery rate is one of the most important factors, and allows the transfer to the recipient mare. This rate comes from a group of elements such as donor´s characteristics, collection date, reproductive management, semen quality, technician skill. Mainly because of the great importance of this direct interference on the results of an embryo recovery program, this study aimed to review the factors involved in embryo recovery rates in donor mares during an embryo transfer, suggesting some ways of improving these results
Resumo:
Pós-graduação em Medicina Veterinária - FCAV