First structural analysis of a naphthalene-based poly(ether ketone): Crystal and molecular simulation from X-ray powder data and diffraction modeling

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

A pressure-jump time-resolved x-ray diffraction study of cubic-cubic transition kinetics in monoolein

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Structure of AuCN determined from total neutron diffraction

The structure of gold cyanide, AuCN, has been determined at 10 and 300 K using total neutron diffraction. The structure consists of infinite -Au-(CN)-Au-(CN)-Au-(CN)- linear chains, hexagonally packed, with the gold atoms in sheets. The Au-C and Au-N bond lengths are found to be identical, with d(Au-C/N) = 1.9703(5) Angstrom at 300 K. This work supersedes a previous study, by others, which used Rietveld analysis of neutron Bragg diffraction in isolation, and found these bonds to have significantly different lengths (Deltad = 0.24 Angstrom) at 300 K. The total correlation function, T(r), at 10 and 300 K, has been modeled using information derived from total diffraction. The broadening of inter- and intrachain correlations differs markedly due to random displacements of the chains in the direction of the chain axes. This is a consequence of the relatively weak bonding between the chains. An explanation for the negative thermal expansion in the c-direction, which occurs between 10 and 300 K, is presented.

Modeling the structure of amorphous MoS3: a neutron diffraction and reverse Monte Carlo study

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

Characterization of the layered structure in main chain dibenzo-18-crown-6 ether polymers by simultaneous WAXS/MAXS-SAXS/DSC measurements

The structure and thermal properties of polymers containing dibenzo-18-crown-6 ether units in the main chain linked to an aliphatic spacer of different lengths (C10-C14) is reported. X-ray diffraction patterns of all the studied samples exhibit a peak in the medium angle region, revealing the existence of a lamellar structure. Simultaneous calorimetry and small, medium (SAXS-MAXS) and wide (WAXS) X-ray measurements during cooling and subsequent heating of the samples reveal that a layer phase is formed upon cooling. In the case of the homopolymers, this phase is almost simultaneously accompanied by the appearance of some reflections in the wide angle region as an indication of lateral crystallization. However, by copolymerization, the formation of the layer phase is decoupled from lateral crystallization, being stable in a wide temperature region.

ExtSym: a program to aid space-group determination from powder diffraction data

Once unit-cell dimensions have been determined from a powder diffraction data set and therefore the crystal system is known (e.g. orthorhombic), the method presented by Markvardsen, David, Johnson & Shankland [Acta Cryst. (2001), A57, 47-54] can be used to generate a table ranking the extinction symbols of the given crystal system according to probability. Markvardsen et al. tested a computer program (ExtSym) implementing the method against Pawley refinement outputs generated using the TF12LS program [David, Ibberson & Matthewman (1992). Report RAL-92-032. Rutherford Appleton Laboratory, Chilton, Didcot, Oxon, UK]. Here, it is shown that ExtSym can be used successfully with many well known powder diffraction analysis packages, namely DASH [David, Shankland, van de Streek, Pidcock, Motherwell & Cole (2006). J. Appl. Cryst. 39, 910-915], FullProf [Rodriguez-Carvajal (1993). Physica B, 192, 55-69], GSAS [Larson & Von Dreele (1994). Report LAUR 86-748. Los Alamos National Laboratory, New Mexico, USA], PRODD [Wright (2004). Z. Kristallogr. 219, 1-11] and TOPAS [Coelho (2003). Bruker AXS GmbH, Karlsruhe, Germany]. In addition, a precise description of the optimal input for ExtSym is given to enable other software packages to interface with ExtSym and to allow the improvement/modification of existing interfacing scripts. ExtSym takes as input the powder data in the form of integrated intensities and error estimates for these intensities. The output returned by ExtSym is demonstrated to be strongly dependent on the accuracy of these error estimates and the reason for this is explained. ExtSym is tested against a wide range of data sets, confirming the algorithm to be very successful at ranking the published extinction symbol as the most likely. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

A differential thermal expansion approach to crystal structure determination from powder diffraction data

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Assessing the date of the global oil peak: the need to use 2P reserves

Combining geological knowledge with proved plus probable ('2P') oil discovery data indicates that over 60 countries are now past their resource-limited peak of conventional oil production. The data show that the global peak of conventional oil production is close. Many analysts who rely only on proved ('1P') oil reserves data draw a very different conclusion. But proved oil reserves contain no information about the true size of discoveries, being variously under-reported, over-reported and not reported. Reliance on 1P data has led to a number of misconceptions, including the notion that past oil forecasts were incorrect, that oil reserves grow very significantly due to technology gain, and that the global supply of oil is ensured provided sufficient investment is forthcoming to 'turn resources into reserves'. These misconceptions have been widely held, including within academia, governments, some oil companies, and organisations such as the IEA. In addition to conventional oil, the world contains large quantities of non-conventional oil. Most current detailed models show that past the conventional oil peak the non-conventional oils are unlikely to come on-stream fast enough to offset conventional's decline. To determine the extent of future oil supply constraints calculations are required to determine fundamental rate limits for the production of non-conventional oils, as well as oil from gas, coal and biomass, and of oil substitution. Such assessments will need to examine technological readiness and lead-times, as well as rate constraints on investment, pollution, and net-energy return. (C) 2007 Elsevier Ltd. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Jpowder: a Java-based program for the display and examination of powder diffraction data

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Energy-dependent cancellation of diffraction spots due to surface roughening

The low-energy electron diffraction (LEED) pattern of the step-kinked Pt{531} surface at 200 K shows energy-dependent cancellation of diffraction spots over unusually large energy ranges, up to 100 eV. This cannot be reproduced theoretically when a flat surface geometry is assumed. A relatively simple model of roughening, however, involving 0.25 ML of vacancies and adatoms leads to very good agreement with the experiment. The cancellation of intensities within a very narrow range of adatom or vacancy coverages is caused by the interference of electrons emerging from different heights but similar local environments. This is a rare example where the energy dependence of integrated LEED spot intensities is dramatically affected by the long-range arrangement of atoms.