895 resultados para Pulsed Dielectrick Barrier Discharge
Resumo:
The main objective of the present study was to analyze the best approach on how to coat paperboard trays at the pressing stage. The coating gives the paperboard enhanced barrier and mechanical properties. The whole process chain of the barrier coating development was studied in the research. The methodology applied includes obtaining the optimum temperature at which good adhesion and bonding is formed between paperboard and skin film. Evaluation of mechanical properties after the coatings; such as cracking, curling and barrier properties was performed.
Resumo:
Tool center point calibration is a known problem in industrial robotics. The major focus of academic research is to enhance the accuracy and repeatability of next generation robots. However, operators of currently available robots are working within the limits of the robot´s repeatability and require calibration methods suitable for these basic applications. This study was conducted in association with Stresstech Oy, which provides solutions for manufacturing quality control. Their sensor, based on the Barkhausen noise effect, requires accurate positioning. The accuracy requirement admits a tool center point calibration problem if measurements are executed with an industrial robot. Multiple possibilities are available in the market for automatic tool center point calibration. Manufacturers provide customized calibrators to most robot types and tools. With the handmade sensors and multiple robot types that Stresstech uses, this would require great deal of labor. This thesis introduces a calibration method that is suitable for all robots which have two digital input ports free. It functions with the traditional method of using a light barrier to detect the tool in the robot coordinate system. However, this method utilizes two parallel light barriers to simultaneously measure and detect the center axis of the tool. Rotations about two axes are defined with the center axis. The last rotation about the Z-axis is calculated for tools that have different width of X- and Y-axes. The results indicate that this method is suitable for calibrating the geometric tool center point of a Barkhausen noise sensor. In the repeatability tests, a standard deviation inside robot repeatability was acquired. The Barkhausen noise signal was also evaluated after recalibration and the results indicate correct calibration. However, future studies should be conducted using a more accurate manipulator, since the method employs the robot itself as a measuring device.
Resumo:
There is a dense serotonergic projection from nucleus raphe pallidus and nucleus raphe obscurus to the trigeminal motor nucleus and serotonin exerts a strong facilitatory action on the trigeminal motoneurons. Some serotonergic neurons in these caudal raphe nuclei increase their discharge during feeding. The objective of the present study was to investigate the possibility that the activity of these serotonergic neurons is related to activity of masticatory muscles. Cats were implanted with microelectrodes and gross electrodes. Caudal raphe single neuron activity, electrocorticographic activity, and splenius, digastric and masseter electromyographic activities were recorded during active behaviors (feeding and grooming), during quiet waking and during sleep. Seven presumed serotonergic neurons were identified. These neurons showed a long duration action potential (>2.0 ms), and discharged slowly (2-7 Hz) and very regularly (interspike interval coefficient of variation <0.3) during quiet waking. The activity of these neurons decreased remarkably during fast wave sleep (78-100%). Six of these neurons showed tonic changes in their activity positively related to digastric and/or masseter muscle activity but not to splenius muscle activity during waking. These data are consistent with the hypothesis that serotonergic neurons in the caudal raphe nuclei play an important role in the control of jaw movements
Resumo:
Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.
Resumo:
Polymerase chain reaction (PCR) with JB1 or REP consensus oligonucleotides and pulsed field gel electrophoresis (PFGE) were used to study genomic DNA extracted from 31 strains of enterococci. Eleven ATCC strains, representative of 11 species of Enterococcus, were initially tested by JB1-PCR, revealing that Enterococcus malodoratus and Enterococcus hirae presented identical banding patterns. Eight Enterococcus faecium isolates from Stanford University and 12 from São Paulo Hospital were studied by JB1-PCR, REP-PCR 1/2R and PFGE. Among the isolates from Stanford University, 5 genotypes were defined by JB1-PCR, 7 by REP-PCR 1/2R and 4 by PFGE. Among the isolates from São Paulo Hospital, 9 genotypes were identified by JB1-PCR, 6 by REP-PCR and 5 by PFGE. The three methods identified identical genotypes, but there was not complete agreement among them.
Resumo:
The objective of this thesis was to study the effect of pulsed electric field on the preparation of TiO2 nanoparticles via sol-gel method. The literature part deals with properties of different TiO2 crystal forms, principles of photocatalysis, sol-gel method and pulsed electric field processing. It was expected that the pulsed electric field would have an influence on crystallite size, specific surface area, polymorphism and photocatalytic activity of produced particles. TiO2 samples were prepared by using different frequencies and treatment times of pulsed electric field. The properties of produced TiO2 particles were examined X-ray diffraction (XRD), Raman spectroscopy and BET surface area analysis. The photocatalytic activities of produced TiO2 particles were determined by using them as photocatalysts for the degradation of formic acid under UVA-light. The photocatalytic activities of samples produced with sol-gel method were also compared with the commercial TiO2 powder Aeroxide® (Evonic Degussa GmbH). Pulsed electric field did not have an effect on the morphology of particles. Results from XRD and Raman analysis showed that all produced TiO2 samples were pure anatase. However, pulsed electric field did have an effect on crystallite size, specific surface area and photocatalytic activity of TiO2 particles. Generally, the crystallite sizes were smaller, specific surface areas larger and initial formic acid degradation rates higher for samples that were produced by applying the pulsed electric field. The higher photocatalytic activities were attributed to larger surface areas and smaller crystallite sizes. Though, with all of the TiO2 samples produced by the sol-gel method the initial formic acid degradation rates were significantly slower than with the commercial TiO2 powder.
Resumo:
The growing pharmaceutical interest, among others, in the polymorphic composition of the emerging solid end-products from production processes has been traced to the need for attainment of high product purity. This is more so as the presence of different polymorphs may constitute physical impurity of the product. Hence, the need for optimization of the yield of desired product component(s) through controlled crystallization kinetics for instance. This study was carried out to investigate the impact of pulsed electric field (PEF) irradiation on the crystal morphology of glycine obtained by cooling crystallization (without seeding) from commercial glycine sample in distilled deionized water solution. In doing so, three different pulse frequencies (294, 950 and 145 Hz) and a case without PEF were studied at three cooling rates (5, 10 and 20 ºC/h). The crystal products obtained were analyzed for polymorphic composition by powder x-ray diffraction (PXRD) and Fourier transform infrared (FTIR) spectroscopy while the particles characterization was done on Morphologi G3. The results obtained from this study showed that pulsed electric field irradiation had significant impact on metastability of the aqueous solution as well as on the polymorphic composition of the end product. With increasing PEF frequency applied, nucleation started earlier and the γ-glycine polymorph content of the product crystals increased. These were found to have been aided by cooling rate, as the most significant effect was observed at 5 ºC/h. It was also discovered that PEF application had no measurable impact on the pH of the aqueous solution as well as the size distribution of the particles. Cooling on the contrary was believed to be responsible for the broadening of the particle size distribution with a downward shift of the lower limit of the raw material from about 100 μm to between 10 and 50 μm.
Resumo:
Tutkimuksen tarkoituksena oli kartoittaa lämpötilan vaikutusta veden orgaanisten haitta-aineiden hapetuksessa PCD-menetelmällä. Kokeita tehtiin näytteiden eri alkulämpötiloilla. Malliyhdisteenä kokeissa käytettiin oksaalihappoa. Teoriaosuudessa käsiteltiin pulssittaista koronapurkausta ilmiönä. Lisäksi tarkasteltiin, kuinka PCD-menetelmällä muodostuu hapettimia neste-kaasufaasissa. Syntyvistä hapettimista keskityttiin otsoniin ja hydroksyyliradikaaliin. Kokeellisessa osuudessa esiteltiin käytetty PCD-laitteisto. Esittelyn jälkeen siirryttiin hapetuskokeiden kuvaamiseen ja analyysin suorittamiseen titrauksella. Lopuksi koottiin tulokset. Tutkimuksissa prosessin hapetustehon havaittiin heikentyvän lämpötilan noustessa tutkitulla lämpötila-alueella, mikä voi selittyä kaasufaasissa muodostuvan otsonin heikentyvällä liukoisuudella. Tuloksia voidaan pitää viitteellisinä, ja selkeän mallin muodostamiseksi tarvitaan jatkotutkimuksia laajemmalla lämpötila-alueella tarkasti toistettavilla koejärjestelyillä.
Resumo:
Neuron-specific enolase (NSE) is a glycolytic enzyme present almost exclusively in neurons and neuroendocrine cells. NSE levels in cerebrospinal fluid (CSF) are assumed to be useful to estimate neuronal injury and clinical outcome of patients with serious clinical manifestations such as those observed in stroke, head injury, anoxic encephalopathy, encephalitis, brain metastasis, and status epilepticus. We compared levels of NSE in serum (sNSE) and in CSF (cNSE) among four groups: patients with meningitis (N = 11), patients with encephalic injuries associated with impairment of consciousness (ENC, N = 7), patients with neurocysticercosis (N = 25), and normal subjects (N = 8). Albumin was determined in serum and CSF samples, and the albumin quotient was used to estimate blood-brain barrier permeability. The Glasgow Coma Scale score was calculated at the time of lumbar puncture and the Glasgow Outcome Scale (GOS) score was calculated at the time of patient discharge or death. The ENC group had significantly higher cNSE (P = 0.01) and albumin quotient (P = 0.005), but not sNSE (P = 0.14), levels than the other groups (Kruskal-Wallis test). Patients with lower GOS scores had higher cNSE levels (P = 0.035) than patients with favorable outcomes. Our findings indicate that sNSE is not sensitive enough to detect neuronal damage, but cNSE seems to be reliable for assessing patients with considerable neurological insult and cases with adverse outcome. However, one should be cautious about estimating the severity of neurological status as well as outcome based exclusively on cNSE in a single patient.
Resumo:
Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.
Resumo:
The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.
Resumo:
The objective of this thesis was to study the effect of pulsed electric field on the preparation of TiO2 nanoparticles via sol-gel method under the visible light irradiation. The literature part introduces properties of different TiO2 crystal forms and principle of photocatalysis. It was expected that pulsed electric field would have an influence on degradation for oxalic acid and formic acid. TiO2 samples were prepared by using three frequencies (50Hz, 294Hz, and 963Hz) and two treatment times (12 minutes and 24 minutes) of pulsed electric field. The photocatalytic activities of TiO2 samples produced with sol-gel method were also compared with the TiO2 particles made by previous study and with the commercial TiO2 powder Aeroxide® (Evonic Degussa GmbH) at the same condition. Results show that pulsed electric field does have an effect on degradation for oxalic acid and formic acid. Generally, higher photocatalytic activities for oxalic acid and formic acid were obtained with lower frequency and longer treatment time of pulsed electric field.
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
We studied the effect of pulsed ultrasound therapy (UST) and antibothropic polyvalent antivenom (PAV) on the regeneration of mouse extensor digitorum longus muscle following damage by Bothrops jararacussu venom. Animals (Swiss male and female mice weighing 25.0 ± 5.0 g; 5 animals per group) received a perimuscular injection of venom (1 mg/kg) and treatment with UST was started 1 h later (1 min/day, 3 MHz, 0.3 W/cm², pulsed mode). Three and 28 days after injection, muscles were dissected and processed for light microscopy. The venom caused complete degeneration of muscle fibers. UST alone and combined with PAV (1.0 mL/kg) partially protected these fibers, whereas muscles receiving no treatment showed disorganized fascicules and fibers with reduced diameter. Treatment with UST and PAV decreased the effects of the venom on creatine kinase content and motor activity (approximately 75 and 48%, respectively). Sonication of the venom solution immediately before application decreased the in vivo and ex vivo myotoxic activities (approximately 60 and 50%, respectively). The present data show that UST counteracts some effects of B. jararacussu venom, causing structural and functional improvement of the regenerated muscle after venom injury.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.