958 resultados para Goodenough’s human figure test
Resumo:
Purpose: Studies on large animal models are an important step to test new therapeutical strategies before human application. Considering the importance of cone function for human vision and the paucity of large animal models for cone dystrophies having an enriched cone region, we propose to develop a pig model for cone degeneration. With a lentiviral-directed transgenesis, we obtained pigs transgenic for a cone-dominant mutant gene described in a human cone dystrophy.Methods: Lentiviral vectors encoding the human double mutant GUCY2DE837D/R838S cDNA under the control of a region of the pig arrestin-3 promoter (Arr3) was produced and used for lentiviral-derived transgenesis in pigs. PCR-genotyping and southern blotting determined the genotype of pigs born after injection of the vector at the zygote stage. Retina function analysis was performed by ERG and behavioral tests at 11, 24 and 54 weeks of age. OCT and histological analyses were performed to describe the retina morphology.Results: The ratio of transgenic pigs born after lentiviral-directed transgenesis was close to 50%. Transgenic pigs with 3 to 5 transgene copies per cell clearly present a reduced photopic response from 3 months of age on. Except for one pig, which has 6 integrated transgene copies, no dramatic decrease in general mobility was observed even at 6 months of age. OCT examinations reveal no major changes in the ONL structure of the 6-months old pigs. The retina morphology was well conserved in the 2 pigs sacrificed (3 and 6 months old) except a noticeable displacement of some cone nuclei in the outer segment layer.Conclusions: Lentiviral-directed transgenesis is a rapid and straightforward method to engineer transgenic pigs. Some Arr3-GUCY2DE837D/R838S pigs show signs of retinal dysfunction but further work is needed to describe the progression of the disease in this model.
Resumo:
INTRODUCTION: Quantitative sensory testing (QST) is widely used in human research to investigate the integrity of the sensory function in patients with pain of neuropathic origin, or other causes such as low back pain. Reliability of QST has been evaluated on both sides of the face, hands and feet as well as on the trunk (Th3-L3). In order to apply these tests on other body-parts such as the lower lumbar spine, it is important first to establish reliability on healthy individuals. The aim of this study was to investigate intra-rater reliability of thermal QST in healthy adults, on two sites within the L5 dermatome of the lumbar spine and lower extremity. METHODS: Test-retest reliability of thermal QST was determined at the L5-level of the lumbar spine and in the same dermatome on the lower extremity in 30 healthy persons under 40 years of age. Results were analyzed using descriptive statistics and intraclass correlation coefficient (ICC). Values were compared to normative data, using Z-transformation. RESULTS: Mean intraindividual differences were small for cold and warm detection thresholds but larger for pain thresholds. ICC values showed excellent reliability for warm detection and heat pain threshold, good-to-excellent reliability for cold pain threshold and fair-to-excellent reliability for cold detection threshold. ICC had large ranges of confidence interval (95%). CONCLUSION: In healthy adults, thermal QST on the lumbar spine and lower extremity demonstrated fair-to-excellent test-retest reliability.
Resumo:
Most common human traits and diseases have a polygenic pattern of inheritance: DNA sequence variants at many genetic loci influence the phenotype. Genome-wide association (GWA) studies have identified more than 600 variants associated with human traits, but these typically explain small fractions of phenotypic variation, raising questions about the use of further studies. Here, using 183,727 individuals, we show that hundreds of genetic variants, in at least 180 loci, influence adult height, a highly heritable and classic polygenic trait. The large number of loci reveals patterns with important implications for genetic studies of common human diseases and traits. First, the 180 loci are not random, but instead are enriched for genes that are connected in biological pathways (P = 0.016) and that underlie skeletal growth defects (P < 0.001). Second, the likely causal gene is often located near the most strongly associated variant: in 13 of 21 loci containing a known skeletal growth gene, that gene was closest to the associated variant. Third, at least 19 loci have multiple independently associated variants, suggesting that allelic heterogeneity is a frequent feature of polygenic traits, that comprehensive explorations of already-discovered loci should discover additional variants and that an appreciable fraction of associated loci may have been identified. Fourth, associated variants are enriched for likely functional effects on genes, being over-represented among variants that alter amino-acid structure of proteins and expression levels of nearby genes. Our data explain approximately 10% of the phenotypic variation in height, and we estimate that unidentified common variants of similar effect sizes would increase this figure to approximately 16% of phenotypic variation (approximately 20% of heritable variation). Although additional approaches are needed to dissect the genetic architecture of polygenic human traits fully, our findings indicate that GWA studies can identify large numbers of loci that implicate biologically relevant genes and pathways.
Resumo:
On June 26-27, 2006, 60 academic and industry scientists gathered during the PROSAFE workshop to discuss recommendations on taxonomy, antibiotic resistance, in vitro assessment of virulence and in vivo assessment of safety of probiotics used for human consumption. For identification of lactic acid bacteria (LAB) intended for probiotic use, it was recommended that conventional biochemical methods should be complemented with molecular methods and that these should be performed by an expert lab. Using the newly developed LAB Susceptibility test Medium (LSM), tentative epidemiological cut-off values were proposed. It was recommended that potentially probiotic strains not belonging to the wildtype distributions of relevant antimicrobials should not be developed as future products for human or animal consumption. Furthermore, it was recommended that the use of strains harbouring known and confirmed virulence genes should be avoided. Finally, for in vivo assessment of safety by investigating strain pathogenicity in animal models, the rat endocarditis model appeared to be the most reliable model tested in the PROSAFE project. Moreover, consensus was reached for approving the necessity of a human colonisation study in a randomised placebo-controlled double-blind design; however, further discussions are needed on the details of such as study.
Resumo:
Introduction: Survival of children born prematurely or with very low birth weight has increased dramatically, but the long term developmental outcome remains unknown. Many children have deficits in cognitive capacities, in particular involving executive domains and those disabilities are likely to involve a central nervous system deficit. To understand their neurostructural origin, we use DTI. Structurally segregated and functionally regions of the cerebral cortex are interconnected by a dense network of axonal pathways. We noninvasively map these pathways across cortical hemispheres and construct normalized structural connection matrices derived from DTI MR tractography. Group comparisons of brain connectivity reveal significant changes in fiber density in case of children with poor intrauterine grown and extremely premature children (gestational age<28 weeks at birth) compared to control subjects. This changes suggest a link between cortico-axonal pathways and the central nervous system deficit. Methods: Sixty premature born infants (5-6 years old) were scanned on clinical 3T scanner (Magnetom Trio, Siemens Medical Solutions, Erlangen, Germany) at two hospitals (HUG, Geneva and CHUV, Lausanne). For each subject, T1-weighted MPRAGE images (TR/TE=2500/2.91,TI=1100, resolution=1x1x1mm, matrix=256x154) and DTI images (30 directions, TR/TE=10200/107, in-plane resolution=1.8x1.8x2mm, 64 axial, matrix=112x112) were acquired. Parent(s) provided written consent on prior ethical board approval. The extraction of the Whole Brain Structural Connectivity Matrix was performed following (Cammoun, 2009 and Hagmann, 2008). The MPARGE images were registered using an affine registration to the non-weighted-DTI and WM-GM segmentation performed on it. In order to have equal anatomical localization among subjects, 66 cortical regions with anatomical landmarks were created using the curvature information, i.e. sulcus and gyrus (Cammoun et al, 2007; Fischl et al, 2004; Desikan et al, 2006) with freesurfer software (http://surfer.nmr.mgh.harvard.edu/). Tractography was performed in WM using an algorithm especially designed for DTI/DSI data (Hagmann et al., 2007) and both information were then combined in a matrix. Each row and column of the matrix corresponds to a particular ROI. Each cell of index (i,j) represents the fiber density of the bundle connecting the ROIs i and j. Subdividing each cortical region, we obtained 4 Connectivity Matrices of different resolution (33, 66, 125 and 250 ROI/hemisphere) for each subject . Subjects were sorted in 3 different groups, namely (1) control, (2) Intrauterine Growth Restriction (IUGR), (3) Extreme Prematurity (EP), depending on their gestational age, weight and percentile-weight score at birth. Group-to-group comparisons were performed between groups (1)-(2) and (1)-(3). The mean age at examination of the three groups were similar. Results: Quantitative analysis were performed between groups to determine fibers density differences. For each group, a mean connectivity matrix with 33ROI/hemisphere resolution was computed. On the other hand, for all matrix resolutions (33,66,125,250 ROI/hemisphere), the number of bundles were computed and averaged. As seen in figure 1, EP and IUGR subjects present an overall reduction of fibers density in both interhemispherical and intrahemispherical connections. This is given quantitatively in table 1. IUGR subjects presents a higher percentage of missing fiber bundles than EP when compared to control subjects (~16% against 11%). When comparing both groups to control subjects, for the EP subjects, the occipito-parietal regions seem less interhemispherically connected whilst the intrahemispherical networks present lack of fiber density in the lymbic system. Children born with IUGR, have similar reductions in interhemispherical connections than the EP. However, the cuneus and precuneus connections with the precentral and paracentral lobe are even lower than in the case of the EP. For the intrahemispherical connections the IUGR group preset a loss of fiber density between the deep gray matter structures (striatum) and the frontal and middlefrontal poles, connections typically involved in the control of executive functions. For the qualitative analysis, a t-test comparing number of bundles (p-value<0.05) gave some preliminary significant results (figure 2). Again, even if both IUGR and EP appear to have significantly less connections comparing to the control subjects, the IUGR cohort seems to present a higher lack of fiber density specially relying the cuneus, precuneus and parietal areas. In terms of fiber density, preliminary Wilcoxon tests seem to validate the hypothesis set by the previous analysis. Conclusions: The goal of this study was to determine the effect of extreme prematurity and poor intrauterine growth on neurostructural development at the age of 6 years-old. This data indicates that differences in connectivity may well be the basis for the neurostructural and neuropsychological deficit described in these populations in the absence of overt brain lesions (Inder TE, 2005; Borradori-Tolsa, 2004; Dubois, 2008). Indeed, we suggest that IUGR and prematurity leads to alteration of connectivity between brain structures, especially in occipito-parietal and frontal lobes for EP and frontal and middletemporal poles for IUGR. Overall, IUGR children have a higher loss of connectivity in the overall connectivity matrix than EP children. In both cases, the localized alteration of connectivity suggests a direct link between cortico-axonal pathways and the central nervous system deficit. Our next step is to link these connectivity alterations to the performance in executive function tests.
Resumo:
L'hyperplasie intimale est la cause majeure de sténoses de pontages veineux. Différents médicaments tels que les statines permettent de prévenir les sténoses mais leur administration systémique n'a que peu d'effet. Nous avons développé une matrice d'hydrogel d'acide hyaluronique qui permet d'avoir un relargage contrôlé d'atorvastatine sur un site désiré. L'enjeu de ce projet de recherche est de démontrer que l'atorvastatine relarguée par l'hydrogel a un effet similaire sur les cellules musculaires lisses de veines saphènes humaines comparé à l'atorvastatine directement diluée dans le milieu de culture. La recherche a été conduite conjointement par le laboratoire de médecine expérimentale du département de chirurgie thoracique et vasculaire du Centre Hospitalier Universitaire Vaudois et de l'Ecole de sciences pharmaceutiques des Universités de Lausanne et de Genève. On a incorporé de l'atorvastatine calcium (Chemos GmbH, Regenstauf Allemagne) dans des gels d'acide hyaluronique (Fortelis extra) à des concentrations déterminées afin de pouvoir analyser le relargage de l'Atovastatine dans le milieu de culture cellulaire par rapport aux concentrations d'atorvastatine directement ajoutées dans le milieu. Des cellules musculaires lisses primaires ont été cultivées à partir d'expiants de veines saphènes humaines. Elles ont été identifiées grâce à l'immunohistochimie par des anticorps contre la desmine et l'alpha-smooth muscle actine. La prolifération et la viabilité de ces cellules ont été analysées à l'aide du test MTT, leur transmigration avec le test de la chambre de Boyden et leur migration avec le principe de cicatrisation de plaies (wound healing assey). L'expression de gènes connus pour participer au développement de l'hyperplasie intimale, tels que la gap junction protein Connexin43 (Cx43), l'inhibiteur du plasminogène PAI-1, Thème oxygénase HO-1, la métalloproteinase-9 et l'inhibiteur de l'activateur du plasminogène tissulaire tPA, a été déterminée par niveau de mRNA exprimé en PCR. Leur expression en protéines a été analysée en utilisant la méthode par Western blots ainsi que l'immunohistochimie. Les expériences ont été effectuées à triple reprise en duplicats en parallèles avec de l'atorvastatine calcium directement ajoutée dans le milieu de culture et avec l'atorvastatine relarguée par l'hydrogel d'acide hyaluronique. Conclusions L'atorvastatine est relarguée par l'hydrogel de façon contrôlée. L'hydrogel contenant l'atorvastatine diminue la viabilité et la transmigration des cellules musculaires lisses de veines saphènes humaines de façon similaire à l'atorvastatine directement introduite dans le milieu de culture. L'hydrogel contenant l'atorvastatine module de façon sélective l'expression de marqueurs de la différentiation cellulaire de cellules musculaires lisses de veines saphènes humaines avec un retard de 24 heures comparé avec les effets de l'atorvastatine directement ajoutée au milieu de culture, sans néanmoins changer la distribution intra-cellulaire des protéines Cx43, HO-1 et PAI-1. Perspectives Il s'agit d'un projet d'importance clinique majeure permettant de réaliser des améliorations du traitement des artériopathies occlusives, ainsi que de relevance pharmacologique permettant de réaliser des dépôts de molécules avec un relargage stable et contrôlé à un site spécifique.
Resumo:
To study the properties of human primary somatosensory (S1) cortex as well as its role in cognitive and social processes, it is necessary to noninvasively localize the cortical representations of the body. Being arguably the most relevant body parts for tactile exploration, cortical representations of fingers are of particular interest. The aim of the present study was to investigate the cortical representation of individual fingers (D1-D5), using human touch as a stimulus. Utilizing the high BOLD sensitivity and spatial resolution at 7T, we found that each finger is represented within three subregions of S1 in the postcentral gyrus. Within each of these three areas, the fingers are sequentially organized (from D1 to D5) in a somatotopic manner. Therefore, these finger representations likely reflect distinct activations of BAs 3b, 1, and 2, similar to those described in electrophysiological work in non-human primates. Quantitative analysis of the local BOLD responses revealed that within BA3b, each finger representation is specific to its own stimulation without any cross-finger responsiveness. This finger response selectivity was less prominent in BA 1 and in BA 2. A test-retest procedure highlighted the reproducibility of the results and the robustness of the method for BA 3b. Finally, the representation of the thumb was enlarged compared to the other fingers within BAs 1 and 2. These findings extend previous human electrophysiological and neuroimaging data but also reveal differences in the functional organization of S1 in human and nonhuman primates. Hum Brain Mapp 35:213-226, 2014. © 2012 Wiley Periodicals, Inc.
Resumo:
The results of numerous economic games suggest that humans behave more cooperatively than would be expected if they were maximizing selfish interests. It has been argued that this is because individuals gain satisfaction from the success of others, and that such prosocial preferences require a novel evolutionary explanation. However, in previous games, imperfect behavior would automatically lead to an increase in cooperation, making it impossible to decouple any form of mistake or error from prosocial cooperative decisions. Here we empirically test between these alternatives by decoupling imperfect behavior from prosocial preferences in modified versions of the public goods game, in which individuals would maximize their selfish gain by completely (100%) cooperating. We found that, although this led to higher levels of cooperation, it did not lead to full cooperation, and individuals still perceived their group mates as competitors. This is inconsistent with either selfish or prosocial preferences, suggesting that the most parsimonious explanation is imperfect behavior triggered by psychological drives that can prevent both complete defection and complete cooperation. More generally, our results illustrate the caution that must be exercised when interpreting the evolutionary implications of economic experiments, especially the absolute level of cooperation in a particular treatment.
Resumo:
Les pontages veineux restent actuellement un traitement de choix dans les pathologies vasculaires occlusives. Cependant, plusieurs problèmes sont liés à ce type de revascularisation. Premièrement, l'hyperplasie intimale (HI) qui cause une resténose dans 20 à 50% des pontages, conduisant à un échec de la revascularisation. Ce processus est dû à la prolifération et à la migration des cellules musculaires lisses vasculaires vers l'intima, ainsi qu'à une sécrétion de protéines de la matrice extracellulaire conduisant à un épaississement de l'intima, principalement au niveau des anastomoses. Deuxièmement, bien qu'il existe des substances connues pour inhiber l'HI, leur administration systémique répétée est associée à une augmentation de leurs effets secondaires. Aucun dispositif ne permet actuellement la libération d'une telle substance localement au site d'une anastomose vasculaire. Nous avons donc développé un hydrogel d'acide hyaluronique compatible avec une application locale au niveau des anastomoses vasculaires et pouvant être chargé en atorvastatine (ATV) (inhibiteur de la 3-hydroxy-3-methylglutaryl-CoA réductase), substance connue pour inhiber l'HI, dans le but de diminuer le fléau de la resténose. Nous avons tout d'abord testé l'effet de ce gel chargé en ATV sur la prolifération, la migration et la transmigration de cellules musculaires lisses primaires en culture provenant de veines saphènes humaines. Ensuite, nous avons étudié son effet sur différents gènes impliqués dans l'HI. Ceci a permis de montrer que l'ATV diminue la prolifération, la migration et la transmigration des cellules musculaires lisses humaines de façon similaire qu'elle soit ajoutée directement au milieu de culture ou qu'elle soit libérée par l'hydrogel chargé. De même, l'ATV régule de manière simultanée mais différentielle les gènes, en interférant avec le développement de l'HI. Nos expériences montrent que l'HI peut être diminuée in vitro grâce à cet hydrogel d'acide hyaluronique chargé en ATV. Ceci ouvre la porte au développement de futur dispositif permettant de relâcher des substances antisténotiques de façon continue, sur une durée prolongée, et in vivo.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Lettuce greenhouse experiments were carried out from March to June 2011 in order to analyze how pesticides behave from the time of application until their intake via human consumption taking into account the primary distribution of pesticides, field dissipation, and post-harvest processing. In addition, experimental conditions were used to evaluate a new dynamic plant uptake model comparing its results with the experimentally derived residues. One application of imidacloprid and two of azoxystrobin were conducted. For evaluating primary pesticide distribution, two approaches based on leaf area index and vegetation cover were used and results were compared with those obtained from a tracer test. High influence of lettuce density, growth stage and type of sprayer was observed in primary distribution showing that low densities or early growth stages implied high losses of pesticides on soil. Washed and unwashed samples of lettuce were taken and analyzed from application to harvest to evaluate removal of pesticides by food processing. Results show that residues found on the Spanish preharvest interval days were in all cases below officially set maximum residue limits, although it was observed that time between application and harvest is as important for residues as application amounts. An overall reduction of 40–60% of pesticides residues was obtained from washing lettuce. Experimentally derived residues were compared with modeled residues and deviate from 1.2 to 1.4 for imidacloprid and azoxystrobin, respectively, presenting good model predictions. Resulting human intake fractions range from... for imidacloprid to ... for azoxystrobin.
Resumo:
The problem of how cooperation can evolve between individuals or entities with conflicting interests is central to biology as many of the major evolutionary transitions, from the first replicating molecules to human societies, have required solving this problem. There are many routes to cooperation but humans seem to be distinct from other species as they have more complex and diverse mechanisms, often due to their higher cognitive skills, allowing them to reap the benefits from living in groups. Among those mechanisms, the use of reputation or past experience with others as well as sanctioning mechanisms both seem to be of major importance. They have often been considered separately but the interaction between the two might provide new insights as to how punishment could have appeared as a means to enforce cooperation in early humans. In this thesis, I firstly use theoretical approaches from evolutionary game theory to investigate the evolution of punishment and cooperation through a reputation system based on punitive actions, and compare the efficacy of this system, in terms of cooperation achieved, with one based on cooperative actions. On the other hand, I use empirical approaches from economics to test, in real life, predictions from theoretical models but also to explore further conditions such as environmental variation, constrained memory, or even the scale of competition between individuals. Both approaches have allowed contributing to the understanding of how these factors affect reputation and punishment use, and ultimately how cooperation is achieved.
Resumo:
The value of various indexes to characterize the stimulus-response curve of human motor nerves was assessed in 40 healthy subjects recruited from four European centers of investigation (Créteil, Lausanne, Liège, Marseille). Stimulus-response curves were established by stimulating the right median and ulnar motor nerves at the wrist, with stimulus durations of 0.05 and 0.5 ms. The following parameters were studied: the threshold intensity of stimulation to obtain 10% (I 10), 50% (I 50), and 90% (I 90) of the maximal compound muscle action potential, the ratios I 10/I 50, I 90/I 50, (I 90 - I 10)/I 10, (I 90-I 50)/I 50, and (I 50 - I 10)/I 10, and the slopes of the stimulus-response curves with or without normalization to I 50. For each parameter, within-center variability and reproducibility (in a test-retest study) were assessed and between-center comparisons were made. For most of the parameters, the results varied significantly within and between the centers. Within the centers, only the ratios I 10/I 50 and I 90/I 50 were found constant and reproducible. Between the centers, the absolute intensity thresholds (I 10, I 50, I 90) and the ratio I 90/I 50 did not show significant differences at stimulus duration of 0.5 ms, whatever the stimulated nerve. The reduced variability and good reproducibility of the ratios I 10/I 50 and I 90/I 50 open perspectives in neurophysiological practice for the use of these indexes of the stimulus-response curve, a rapid and noninvasive test.
Resumo:
BACKGROUND: Active screening by mobile teams is considered the best method for detecting human African trypanosomiasis (HAT) caused by Trypanosoma brucei gambiense but the current funding context in many post-conflict countries limits this approach. As an alternative, non-specialist health care workers (HCWs) in peripheral health facilities could be trained to identify potential cases who need testing based on their symptoms. We explored the predictive value of syndromic referral algorithms to identify symptomatic cases of HAT among a treatment-seeking population in Nimule, South Sudan. METHODOLOGY/PRINCIPAL FINDINGS: Symptom data from 462 patients (27 cases) presenting for a HAT test via passive screening over a 7 month period were collected to construct and evaluate over 14,000 four item syndromic algorithms considered simple enough to be used by peripheral HCWs. For comparison, algorithms developed in other settings were also tested on our data, and a panel of expert HAT clinicians were asked to make referral decisions based on the symptom dataset. The best performing algorithms consisted of three core symptoms (sleep problems, neurological problems and weight loss), with or without a history of oedema, cervical adenopathy or proximity to livestock. They had a sensitivity of 88.9-92.6%, a negative predictive value of up to 98.8% and a positive predictive value in this context of 8.4-8.7%. In terms of sensitivity, these out-performed more complex algorithms identified in other studies, as well as the expert panel. The best-performing algorithm is predicted to identify about 9/10 treatment-seeking HAT cases, though only 1/10 patients referred would test positive. CONCLUSIONS/SIGNIFICANCE: In the absence of regular active screening, improving referrals of HAT patients through other means is essential. Systematic use of syndromic algorithms by peripheral HCWs has the potential to increase case detection and would increase their participation in HAT programmes. The algorithms proposed here, though promising, should be validated elsewhere.