899 resultados para Formation of the theoretical conceptions


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Formation of the so far elusive chrysene excimer in solution is achieved by using DNA as a supramolecular scaffold. Oligonucleotides possessing one or two chrysene building blocks have been synthesized. Chrysene excimer fluorescence has been unambiguously observed in DNA double strands, as well as in single strands containing two neighbouring chrysenes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cells infected with MuSVts110 express a viral RNA which contains an inherent conditional defect in RNA splicing. It has been shown previously that splicing of the MuSVts110 primary transcript is essential to morphological transformation of 6m2 cells in vitro. A growth temperature of 33$\sp\circ$C is permissive for viral RNA splicing,and, consequently, 6m2 cells appear morphologically transformed at this temperature. However, 6m2 cells appear phenotypically normal when incubated at 39$\sp\circ$C, the non-permissive temperature for viral RNA splicing.^ After a shift from 39$\sp\circ$C to 33$\sp\circ$C, the coordinate splicing of previously synthesized and newly transcribed MuSVts110 RNA was achieved. By S1 nuclease analysis of total RNA isolated at various times, 5$\sp\prime$ splice site cleavage of the MuSVts110 transcript appeared to occur 60 minutes after the shift to 33$\sp\circ$C, and 30 minutes prior to detectable exon ligation. In addition, consistent with the permissive temperatures and the kinetic timeframe of viral RNA splicing after a shift to 33$\sp\circ$C, four temperature sensitive blockades to primer extension were identified 26-75 bases upstream of the 3$\sp\prime$ splice site. These blockades likely reflect four branchpoint sequences utilized in the formation of MuSVts110 lariat splicing-intermediates.^ The 54-5A4 cell line is a spontaneous revertant of 6m2 cells and appears transformed at all growth temperatures. Primer extension sequence analysis has shown that a five base deletion occurred at the 3$\sp\prime$ splice site in MuSVts110 RNA allowing the expression of a viral transforming protein in 54-5A4 in the absence of RNA splicing, whereas in the parental 6m2 cell line, a splicing event is necessary to generate a similar transforming protein. As a consequence of this deletion, splicing cannot occur and the formation of the four MuSVts110 branched-intermediates were not observed at any temperature in 54-5A4 cells. However, 5$\sp\prime$ splice site cleavage was still detected at 33$\sp\circ$C.^ Finally, we have investigated the role of the 1488 bp deletion which occurred in the generation of MuSVts110 in the activation of temperature sensitive viral RNA splicing. This deletion appears solely responsible for splice site activation. Whether intron size is the crucial factor in MuSVts110 RNA splicing or whether inhibitory sequences were removed by the deletion is currently unknown. (Abstract shortened with permission of author.) ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study reviews and synthesizes the present knowledge on the Sesia–Dent Blanche nappes, the highest tectonic elements in the Western Alps (Switzerland and Italy), which comprise pieces of pre-Alpine basement and Mesozoic cover. All of the available data are integrated in a crustal-scale kinematic model with the aim to reconstruct the Alpine tectono-metamorphic evolution of the Sesia–Dent Blanche nappes. Although major uncertainties remain in the pre-Alpine geometry, the basement and cover sequences of the Sesia–Dent Blanche nappes are seen as part of a thinned continental crust derived from the Adriatic margin. The earliest stages of the Alpine evolution are interpreted as recording late Cretaceous subduction of the Adria-derived Sesia–Dent Blanche nappes below the South-Alpine domain. During this subduction, several sheets of crustal material were stacked and separated by shear zones that rework remnants of their Mesozoic cover. The recently described Roisan-Cignana Shear Zone of the Dent Blanche Tectonic System represents such a shear zone, indicating that the Sesia–Dent Blanche nappes represent a stack of several individual nappes. During the subsequent subduction of the Piemonte–Liguria Ocean large-scale folding of the nappe stack (including the Roisan-Cignana Shear Zone) took place under greenschist facies conditions, which indicates partial exhumation of the Dent Blanche Tectonic System. The entrance of the Briançonnais micro-continent within the subduction zone led to a drastic change in the deformation pattern of the Alpine belt, with rapid exhumation of the eclogite-facies ophiolite bearing units and thrust propagation towards the foreland. Slab breakoff probably was responsible for allowing partial melting in the mantle and Oligocene intrusions into the most internal parts of the Sesia–Dent Blanche nappes. Finally, indentation of the Adriatic plate into the orogenic wedge resulted in the formation of the Vanzone back-fold, which marks the end of the pervasive ductile deformation within the Sesia–Dent Blanche nappes during the earliest Miocene.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The nail unit is the largest and a rather complex skin appendage. It is located on the dorsal aspect of the tips of fingers and toes and has important protective and sensory functions. Development begins in utero between weeks 7 and 8 and is fully formed at birth. For its correct development, a great number of signals are necessary. Anatomically, it consists of 4 epithelial components: the matrix that forms the nail plate; the nail bed that firmly attaches the plate to the distal phalanx; the hyponychium that forms a natural barrier at the physiological point of separation of the nail from the bed; and the eponychium that represents the undersurface of the proximal nail fold which is responsible for the formation of the cuticle. The connective tissue components of the matrix and nail bed dermis are located between the corresponding epithelia and the bone of the distal phalanx. Characteristics of the connective tissue include: a morphogenetic potency for the regeneration of their epithelia; the lateral and proximal nail folds form a distally open frame for the growing nail; and the tip of the digit has rich sensible and sensory innervation. The blood supply is provided by the paired volar and dorsal digital arteries. Veins and lymphatic vessels are less well defined. The microscopic anatomy varies from nail subregion to subregion. Several different biopsy techniques are available for the histopathological evaluation of nail alterations.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Formation of the FtsZ ring (Z ring) in Escherichia coli is the first step in assembly of the divisome, a molecular machine composed of 14 known proteins which are all required for cell division. Although the biochemical functions of most divisome proteins are unknown, several of these have overlapping roles in ensuring that the Z ring assembles at the cytoplasmic membrane and is active. ^ We identified a single amino acid change in FtsA, R286W, renamed FtsA*, that completely bypasses the requirement for ZipA in cell division. This and other data suggest that FtsA* is a hyperactive form of FtsA that can replace the multiple functions normally assumed by ZipA, which include stabilization of Z rings, recruitment of downstream cell division proteins, and anchoring the Z ring to the membrane. This is the first example of complete functional replacement of an essential prokaryotic cell division protein by another. ^ Cells expressing ftsA* with a complete deletion of ftsK are viable and divide, although many of these ftsK null cells formed multiseptate chains, suggesting a role in cell separation for FtsK. In addition, strains expressing extra ftsAZ, ftsQ, ftsB, zipA or ftsN, were also able to survive and divide in the absence of ftsK. The cytoplasmic and transmembrane domains of FtsQ were sufficient to allow viability and septum formation to ftsK deleted strains. These findings suggest that FtsK is normally involved in stabilizing the divisome and shares functional overlap with other cell division proteins. ^ As well as permitting the removal of other divisome components, the presence of FtsA* in otherwise wild-type cells accelerated Z-ring assembly, which resulted in a significant decrease in the average length of cells. In support of its role in Z-ring stability, FtsA* suppressed the cell division inhibition caused by overexpressing FtsZ. FtsA* did not affect FtsZ turnover within the Z ring as measured by fluorescence recovery after photobleaching. Turnover of FtsA* in the ring was somewhat faster than wild-type FtsA. Yeast two-hybrid data suggest that FtsA* has an increased affinity for FtsZ relative to wild-type FtsA. These results indicate that FtsA* interacts with FtsZ more strongly, and its enhancement of Z ring assembly may explain why FtsA* can permit survival of cells lacking ZipA or FtsK.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Regardless of genetic sex, amniotes develop two sets of genital ducts, the Wolffian and Müllerian ducts. Normal sexual development requires the differentiation of one duct and the regression of the other. I show that cells in the rostral most region of the coelomic epithelium (CE) are specified to a Müllerian duct fate beginning at Tail Somite Stage 19 (TS19). The Müllerian duct (MD) invaginates from the CE where it extends caudally to and reaches the Wolffian duct (WD) by TS22. Upon contact, the MD elongates to the urogenital sinus separating the WD from the CE and its formation is complete by TS34. During its elongation, the MD is associated with and dependent upon the WD and I have identified the mechanism for MD elongation. Using the Rosa26 reporter to fate map the WD, I show that the WD does not contribute cells to the MD. Using an in vitro recombinant explant culture assay I show that the entire length of the MD is derived from the CE. Furthermore, I analyzed cell proliferation and developed an in vitro assay to show that a small population of cells at the caudal tip proliferates, laying the foundation for the formation of the MD. I also show that during its formation, the MD has a distinctive mesoepithelial character. The MD in males regresses under the influence of Anti-Müllerian Hormone (AMH). Through tissue-specific gene inactivation I have identified that Acvr1 and Bmpr1a and Smad1, Smad5 and Smad8 function redundantly in transducing the AMH signal. In females the MD differentiates into an epithelial tube and eventually the female reproductive tract. However, the exact tissue into which the MD differentiates has not been determined. I therefore generated a MD specific Cre allele that will allow for the fate mapping of the MD in both females males. The MD utilizes a unique form of tubulogenesis during development and to my knowledge is the only tubule that relies upon a signal from and the presence of another distinct epithelial tube for its formation.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Ion channels play a crucial role in the functioning of different systems of the body because of their ability to bridge the cell membrane and allow ions to pass in and out of the cell. Ionotropic glutamate receptors are one class of these important proteins and have been shown to be critical in propagating synaptic transmission in the central nervous system and in other diverse functions throughout the body. Because of their wide-ranging effects, this family of receptors is an important target for structure-function investigations to understand their mechanism of action. ^ α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors are one subtype of glutamate receptors and have been shown to be the primary receptors involved in rapid excitatory signaling in the central nervous system. Agonist binding to the extracellular ligand binding domain of these receptors causes various conformational changes that culminate in formation of the ion channel. Previous structural investigations have provided important information about their mechanism of action, including uncovering a relationship between the degree of cleft closure in the binding domain and activation of the receptor. However, what question remains unanswered is how specific interactions between the agonist and the protein interplay with cleft closure to mediate receptor activation. ^ To investigate this question, I applied a multiscale approach to investigate the effects of agonist binding on various levels. Vibrational spectroscopy was utilized to investigate molecular-level interactions in the binding pocket, and fluorescence resonance energy transfer (FRET) was employed to measure cleft closure in the isolated ligand binding domain. The results of these studies in the isolated binding domain were then correlated to activation of the full receptor. These investigations showed a relationship between the strength of the interaction at the α-amine group of the agonist and extent of receptor activation, where a stronger interaction correlated to a larger activation, which was upheld even when the extent of cleft closure did not correlate to activation. These results show that this interaction at the α-amine group is critical in mediating the allosteric mechanism of activation and provide a bit more insight into how agonist binding is coupled to channel gating in AMPA receptors. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Infection by human immunodeficiency virus type 1 (HIV-1) is a multi-step process, and detailed analyses of the various events critical for productive infection are necessary to clearly understanding the infection process and identifying novel targets for therapeutic interventions. Evidence from this study reveals binding of the viral envelope protein to host cell glycosphingolipids (GSLs) as a novel event necessary for the orderly progression of the host cell-entry and productive infection by HIV-1. Data obtained from co-immunoprecipitation analyses and confocal microscopy showed that the ability of viral envelope to interact with the co-receptor CXCR4 and productive infection of HIV-1 were inhibited in cells rendered GSL-deficient, while both these activities were restored after reconstitution of the cells with specific GSLs like GM3. Furthermore, evidence was obtained using peptide-inhibitors of HIV-1 infection to show that binding of a specific region within the V3-loop of the envelope protein gp120 to the host cell GSLs is the trigger necessary for the CD4-bound gp120 to recruit the CXCR4 co-receptor. Infection-inhibitory activity of the V3 peptides was compromised in GSL-deficient cells, but could be restored by reconstitution of GSLs. Based on these findings, a revised model for HIV-1 infection is proposed that accounts for the established interactions between the viral envelope and host cell receptors while enumerating the importance of the new findings that fill the gap in the current knowledge of the sequential events for the HIV-1 entry. According to this model, post-CD4 binding of the HIV-1 envelope surface protein gp120 to host cell GSLs, mediated by the gp120-V3 region, enables formation of the gp120-CD4-GSL-CXCR4 immune-complex and productive infection. The identification of cellular GSLs as an additional class of co-factors necessary for HIV-1 infection is important for enhancing the basic knowledge of the HIV-1 entry that can be exploited for developing novel antiviral therapeutic strategies. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In January/February 1985 a German-South African expedition had the opportunity to repeat measurements made by means of stakes planted in 1951 (Norwegian-British-Swedish Antarctic Expedition 1949-52) and 1966 (SANAE VII). Although the rediscovery of the old stakes had not been expected, the stakes could be identified and it was possible to derive movement vectors on the basis of old and heterogenic measurement data. The long-term movement rates established basically confirm and complement the values determined in 1951. The flow rates of 9,1 cm/a to 66.4 cm/a proved to be extremly low. Observations of the stake lengths showed very little accumulation in the fringe areas of the blue ice-field (ca. 0.7 to 2.6 cm/a snow/firn); on bare ice an ablation of 2.6 cm/a water equivalent (2.9 cm/a ice) was measured. The paper begins with a description of the essential conditions for the formation of the blue ice-field. Subsequently the measurements are explained in detail and their results are discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Authigenic phosphatic laminites enclosed in phosphorite crusts from the shelf off Peru (10°01' S and 10°24' S) consist of carbonate fluorapatite layers, which contain abundant sulfide minerals including pyrite (FeS2) and sphalerite (ZnS). Low d34Spyrite values (average -28.8 per mill) agree with bacterial sulfate reduction and subsequent pyrite formation. Stable sulfur isotopic compositions of sulfate bound in carbonate fluorapatite are lower than that of sulfate from ambient sea water, suggesting bacterial reoxidation of sulfide by sulfide-oxidizing bacteria. The release of phosphorus and subsequent formation of the autochthonous phosphatic laminites are apparently caused by the activity of sulfate-reducing bacteria and associated sulfide-oxidizing bacteria. Following an extraction-phosphorite dissolution-extraction procedure, molecular fossils of sulfate-reducing bacteria (mono-O-alkyl glycerol ethers, di-O-alkyl glycerol ethers, as well as the short-chain branched fatty acids i/ai-C15:0, i/ai-C17:0 and 10MeC16:0) are found to be among the most abundant compounds. The fact that these molecular fossils of sulfate-reducing bacteria are distinctly more abundant after dissolution of the phosphatic laminite reveals that the lipids are tightly bound to the mineral lattice of carbonate fluorapatite. Moreover, compared with the autochthonous laminite, molecular fossils of sulfate-reducing bacteria are: (1) significantly less abundant and (2) not as tightly bound to the mineral lattice in the other, allochthonous facies of the Peruvian crusts consisting of phosphatic coated grains. These observations confirm the importance of sulfate-reducing bacteria in the formation of the phosphatic laminite. Model calculations highlight that organic matter degradation by sulfate-reducing bacteria has the potential to liberate sufficient phosphorus for phosphogenesis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Distribution of ammonium, nitrite and nitrate nitrogen is examined in a section along 65-67°E between 18°S and 23°N during the transition period from winter to summer monsoons. It is shown that, under conditions of very large oxygen deficit in the 200-400 m layer, denitrification process results in formation of the second deep-sea maximum of nitrites and the intermediate minimum of nitrate nitrogen.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Qualitative and quantitative evaluation of the finely dispersed fraction of particulate organic matter in sea water is given. It is demonstrated that in the euphotic zone of high productivity waters this fraction constitutes 86%, in waters with low productivity 61%, and in deep waters (>200 m) 53% of the organic carbon in particulate matter. Formation of the finely dispersed fraction and its role in distribution of energy in the detrital food chain of the ecosystem are discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In the Persian Gulf and the Gulf of Oman marl forms the primary sediment cover, particularly on the Iranian side. A detailed quantitative description of the sediment components > 63 µ has been attempted in order to establish the regional distribution of the most important constituents as well as the criteria governing marl sedimentation in general. During the course of the analysis, the sand fraction from about 160 bottom-surface samples was split into 5 phi° fractions and 500 to 800 grains were counted in each individual fraction. The grains were cataloged in up to 40 grain type catagories. The gravel fraction was counted separately and the values calculated as weight percent. Basic for understanding the mode of formation of the marl sediment is the "rule" of independent availability of component groups. It states that the sedimentation of different component groups takes place independently, and that variation in the quantity of one component is independent of the presence or absence of other components. This means, for example, that different grain size spectrums are not necessarily developed through transport sorting. In the Persian Gulf they are more likely the result of differences in the amount of clay-rich fine sediment brought in to the restricted mouth areas of the Iranian rivers. These local increases in clayey sediment dilute the autochthonous, for the most part carbonate, coarse fraction. This also explains the frequent facies changes from carbonate to clayey marl. The main constituent groups of the coarse fraction are faecal pellets and lumps, the non carbonate mineral components, the Pleistocene relict sediment, the benthonic biogene components and the plankton. Faecal pellets and lumps are formed through grain size transformation of fine sediment. Higher percentages of these components can be correlated to large amounts of fine sediment and organic C. No discernable change takes place in carbonate minerals as a result of digestion and faecal pellet formation. The non-carbonate sand components originate from several unrelated sources and can be distinguished by their different grain size spectrum; as well as by other characteristics. The Iranian rivers supply the greatest amounts (well sorted fine sand). Their quantitative variations can be used to trace fine sediment transport directions. Similar mineral maxima in the sediment of the Gulf of Oman mark the path of the Persian Gulf outflow water. Far out from the coast, the basin bottoms in places contain abundant relict minerals (poorly sorted medium sand) and localized areas of reworked salt dome material (medium sand to gravel). Wind transport produces only a minimal "background value" of mineral components (very fine sand). Biogenic and non-biogenic relict sediments can be placed in separate component groups with the help of several petrographic criteria. Part of the relict sediment (well sorted fine sand) is allochthonous and was derived from the terrigenous sediment of river mouths. The main part (coarse, poorly sorted sediment), however, was derived from the late Pleistocene and forms a quasi-autochthonous cover over wide areas which receive little recent sedimentation. Bioturbation results in a mixing of the relict sediment with the overlying younger sediment. Resulting vertical sediment displacement of more than 2.5 m has been observed. This vertical mixing of relict sediment is also partially responsible for the present day grain size anomalies (coarse sediment in deep water) found in the Persian Gulf. The mainly aragonitic components forming the relict sediment show a finely subdivided facies pattern reflecting the paleogeography of carbonate tidal flats dating from the post Pleistocene transgression. Standstill periods are reflected at 110 -125m (shelf break), 64-61 m and 53-41 m (e.g. coare grained quartz and oolite concentrations), and at 25-30m. Comparing these depths to similar occurrences on other shelf regions (e. g. Timor Sea) leads to the conclusion that at this time minimal tectonic activity was taking place in the Persian Gulf. The Pleistocene climate, as evidenced by the absence of Iranian river sediment, was probably drier than the present day Persian Gulf climate. Foremost among the benthonic biogene components are the foraminifera and mollusks. When a ratio is set up between the two, it can be seen that each group is very sensitive to bottom type, i.e., the production of benthonic mollusca increases when a stable (hard) bottom is present whereas the foraminifera favour a soft bottom. In this way, regardless of the grain size, areas with high and low rates of recent sedimentation can be sharply defined. The almost complete absence of mollusks in water deeper than 200 to 300 m gives a rough sedimentologic water depth indicator. The sum of the benthonic foraminifera and mollusca was used as a relative constant reference value for the investigation of many other sediment components. The ratio between arenaceous foraminifera and those with carbonate shells shows a direct relationship to the amount of coarse grained material in the sediment as the frequence of arenaceous foraminifera depends heavily on the availability of sand grains. The nearness of "open" coasts (Iranian river mouths) is directly reflected in the high percentage of plant remains, and indirectly by the increased numbers of ostracods and vertebrates. Plant fragments do not reach their ultimate point of deposition in a free swimming state, but are transported along with the remainder of the terrigenous fine sediment. The echinoderms (mainly echinoids in the West Basin and ophiuroids in the Central Basin) attain their maximum development at the greatest depth reached by the action of the largest waves. This depth varies, depending on the exposure of the slope to the waves, between 12 to 14 and 30 to 35 m. Corals and bryozoans have proved to be good indicators of stable unchanging bottom conditions. Although bryozoans and alcyonarian spiculae are independent of water depth, scleractinians thrive only above 25 to 30 m. The beginning of recent reef growth (restricted by low winter temperatures) was seen only in one single area - on a shoal under 16 m of water. The coarse plankton fraction was studied primarily through the use of a plankton-benthos ratio. The increase in planktonic foraminifera with increasing water depth is here heavily masked by the "Adjacent sea effect" of the Persian Gulf: for the most part the foraminifera have drifted in from the Gulf of Oman. In contrast, the planktonic mollusks are able to colonize the entire Persian Gulf water body. Their amount in the plankton-benthos ratio always increases with water depth and thereby gives a reliable picture of local water depth variations. This holds true to a depth of around 400 m (corresponding to 80-90 % plankton). This water depth effect can be removed by graphical analysis, allowing the percentage of planktonic mollusks per total sample to be used as a reference base for relative sedimentation rate (sedimentation index). These values vary between 1 and > 1000 and thereby agree well with all the other lines of evidence. The "pteropod ooze" facies is then markedly dependent on the sedimentation rate and can theoretically develop at any depth greater than 65 m (proven at 80 m). It should certainly no longer be thought of as "deep sea" sediment. Based on the component distribution diagrams, grain size and carbonate content, the sediments of the Persian Gulf and the Gulf of Oman can be grouped into 5 provisional facies divisions (Chapt.19). Particularly noteworthy among these are first, the fine grained clayey marl facies occupying the 9 narrow outflow areas of rivers, and second, the coarse grained, high-carbonate marl facies rich in relict sediment which covers wide sediment-poor areas of the basin bottoms. Sediment transport is for the most part restricted to grain sizes < 150 µ and in shallow water is largely coast-parallel due to wave action at times supplemented by tidal currents. Below the wave base gravity transport prevails. The only current capable of moving sediment is the Persian Gulf outflow water in the Gulf of Oman.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Drilling at site 207 (DSDP Leg 21), located on the broad summit of the Lord Howe Rise, bottomed in rhyolitic rocks. Sanidine concentrates from four samples of the rhyolite were dated by the 40Ar/39Ar total fusion method and conventional K-Ar method, and yielded concordant ages of 93.7 +/- 1.1 my, equivalent to the early part of the Upper Cretaceous. At this time the Lord Howe Rise, which has continental-type structure, is thought to have been emergent and adjacent to the eastern margin of the Australian-antarctic continent. Subsequent to 94 my ago and prior to deposition of Maastrichtian (70-65 myBP) marine sediments on top of the rhyolitic basement of the Lord Howe Rise, rifting occurred and the formation of the Tasman Basin began by sea-floor spreading with rotation of the Rise away from the margin of Australia. Subsidence of the Rise continued until Early Eocene (about 50 myBP), probably marking the end of sea-floor spreading in the Tasman Basin. These large scale movements relate to the breakup of this part of Gondwanaland in the Upper Cretaceous.