597 resultados para CAB
Resumo:
O objetivo do presente trabalho foi testar a indução e sincronização do estro em ovelhas utilizando-se diferentes períodos de permanência do progestágeno, dose única de PGF2α ou efeito macho. Para tanto dois experimentos foram realizados: no experimento 1, as ovelhas (n=48) receberam esponjas vaginais impregnadas com MAP (medroxiprogesterona) e foram divididas em 2 grupos: G-9 e G-14, ou seja, MAP por nove ou 14 dias com aplicação de PGF2α na retirada do progestágeno e detecção de estro com reprodutores. Não houve diferenças (p<0,05) na manifestação no estro (69,6 % e 80%), na porcentagem de prenhez (34,8% e 44%) ou de concepção (50% e 55%) nos grupos G-9 e G-14, respectivamente. No experimento 2, as ovelhas (n=151) foram aleatoriamente divididas em 3 grupos: G-6, cada ovelha recebeu MAP por seis dias e aplicação de PGF2α na retirada do progestágeno; G-PGF, cada ovelha recebeu dose única de PGF2α e G-EM para avaliar o efeito macho foram introduzidos machos entre ovelhas previamente separadas dos mesmos. A porcentagem de manifestação de estro foi maior (p<0,05) nos grupos G-6 (58%) e G-PGF (39%) quando comparados ao G-EM (11%). Concluímos ser possível diminuir o tempo de permanência do progestágeno, porém o uso de luteolítico, em período de transição da estacionalidade reprodutiva, sem o progestágeno, resulta em baixa manifestação de estro.
Resumo:
The present study aimed at evaluating the productive performance of Leporinus macrocephalus fed with different levels of inclusion of poultry viscera meal replacing fish meal. The experiment was conducted in a stove located in the Universidade Estadual do Oeste do Paraná during 45 days. We used 200 fish with average initial length of 4.7 ± 0.37 cm and average initial weight of 1.407 ± 0.03 g, distributed in 20 net-cages. The experimental design was randomized with five treatments and five replicates with five levels of replacement of fish meal by poultry viscera meal (0, 25, 50, 75, 100%). The parameters evaluated were the productive performance and the chemical composition of animals. The inclusion of poultry viscera meal in the substitution of fish meal in the feeding of Leporinus macrocephalus can be used without impairing the performance of the animals.
Resumo:
The aim of this study was to evaluate the association between cryoprotectants little studied in Brazil such as dimethylformamide and trehalose amid thinner, using protocols of fast and slow defrosting. Three adult Labrador Retrievier male, healthy dogs, weekly submitted to one semen collection during five-weeks period, were used. The base diluent medium used in this study was tris-citrate added with 3% of dimethylformamide + 3% glycerol (D1), 3% dimethylformamide and trehalose (D2) and 4% glycerol (D3). At defrosting, half of the semen samples from each diluent medium was defrosted by rapid method in water-bath at 75 °C for seven minutes, followed by a new immersion at 37 °C for 1 minute. The other half of the samples was defrosted by slow method, in water-bath at 37 °C for 1 minute. The semen was evaluated for sperm progressive motility and vigor, besides membrane integrity. For this, the semen samples were submitted to either hyposmotic and membrane integrity tests of the plasmatic membrane and acrosome (fluorescence). The results indicated that the use of glycerol as cryoprotector in TRIS diluter provides greater efficacy in cryopreserving spermatozoa of the canine species, when compared to dimethylformamide associated with trehalose or glycerol.
Resumo:
Prostatic lesions such as prostatic intraepithelial neoplasia (PIN) and proliferative inflammatory atrophy (PIA) are studied in human and canine species due to their malignance potential. The plasminogen activator (PA) system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR) is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC) was evaluated by immunohistochemistry in a tissue microarray (TMA) slide to establish the role of this enzyme in extracellular matrix (ECM) remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1%) normal prostates, 46 (13.0%) with BPH, 128 (36.1%) with PIA, 74 (20.8%) with PIN and 71 (20.0%) with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.
Resumo:
Newcastle disease, salmonellosis and mycoplamosis are the most important infectious diseases in poultry. Toxoplamosis is a common disease in urban environment. The present study investigated serologic evidence of these diseases in captive and wildlife birds, with rapid plate agglutination test, haemagglutination inhibition test, and modified agglutination test. In a total of 117 blood serum samples, 20 showed the presence of Toxoplasma gondii, Mycoplasma gallisepticum, and Salmonella spp. antibodies. Amazona aestiva was the specie with the highest number of positive individuals (13/20). We also verified the first detection of T. gondii antibodies in birds of prey from Mivalgo chimachima and Rupornis magnirostris species.
Resumo:
This study was developed with the aim of evaluating recombinant bovine somatotropin (rbST) on non-carcass components of goat kids of three genotypes. It was used 23 male goat kids of three genotypes, being 8 Alpine, 4 ½ Boer + ½ Alpine (½ BA) and 11 ¾ Boer + ¼Alpine (¾ BA), from which 12 received rbST e 11 control. The growth hormone used was the recombinant bovine somatotropin (rbST) and animals of treatment 1 received the hormone in the amount of 0.3 mg/kg live weight, from 45 days, adjusted in intervals of 14 days. Animals of treatment 2 (control) received saline solution in the same dosage and interval. The ½ BA goats presented a higher proportion of external non-carcass components (head, feet and skin) in relation to Alpine goats. Regarding the vital organs, such as lungs, kidneys and spleen, and the non-carcass components blood, internal fat and perinephric fat, Alpine goats presented higher values than ¾ BA goats. The administration of recombinant bovine somatotropin (rbST) did not produce effect on proportions and weight of non-carcass components. Proportions and weight of non-carcass components varied in function of genotypes, although animals were slaughtered at similar live weight.
Resumo:
The aim of the study was to analyze and compare the ultrasound characteristics of adrenal glands between healthy puppies and kittens by establishing standards of normality and references. Fifteen healthy crossbred puppies with mean weight of 3 kg and fifteen healthy crossbred kittens with mean weight of 2 kg, aged between five and six months, participated in the study. The animals were submitted to ultrasound exam of adrenal glands for visualization of their internal characteristics. The frequency of visualization of adrenal glands was 100% in kittens. In puppies the frequency was 75% for the right gland and 100% for the left gland. The puppy's adrenal gland, both right and left, were bigger in length (1.08 ± 0.01 cm, 1.11 ± 0.01 cm) and width (0.42 ± 0.02 cm, 0.45 ± 0.01 cm) in relation to kittens' adrenal gland length (0.64 ± 0.01 cm, 0.63 ± 0.01 cm) and width (0.30 ± 0.02 cm, 0.34 ± 0.01 cm). The adrenal gland of puppies and kittens was hypoechogenic to the surrounded fat, delimited by a hyperechogenic line and without distinction of the cortical and medullar region. The ultrasound dimensions of length and width of the adrenal glands, both right and left, were the same in puppies and kittens. The right and left puppies' adrenal glands were longer and wider than the kittens' glands.
Resumo:
The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Comparou-se a produção de embriões a partir de ovócitos oriundos de ovários com e sem corpo lúteo de vacas da raça Nelore, em relação à qualidade e quantidade de ovócitos obtidos, embriões produzidos, taxa de prenhez e proporção dos sexos. Foram realizadas aspirações foliculares dos dois ovários de 219 vacas em 250 seções, igualmente distribuídas em cinco grupos, sendo G1=fêmeas gestantes; G2=não gestantes, com CL e submetidas a tratamento hormonal com progestágeno+BE+PGF2∝; G3=não gestantes, sem CL e com o mesmo tratamento de G2; G4=não gestantes, com presença de CL e sem tratamento; G5=não gestantes, sem presença de CL e sem tratamento. Os resultados foram avaliados pela análise de variância (ANOVA) e aplicado o Teste de Tukey para comparação entre médias, a 5% de significância, pelo programa SISVAR. Já para comparação de proporção de sexos dentro e entre os grupos, foi utilizado o teste de comparação múltipla de proporções. O G4 produziu maior média de ovócitos totais aspirados que G2 e G3. Comparando-se os três grupos que apresentavam CL (G1, G2, G4), o G4 foi superior a G1 e G2 em ovócitos totais, no ovário com e sem CL. Em ovócitos viáveis, G2 foi superior a G1 no ovário com CL. Os ovócitos obtidos de ovários com CL é que resultaram em melhores índices de produção de embriões. As vacas gestantes produziram melhor nos ovários sem CL, com mais ovócitos viáveis (p<0,05) e iguais em embriões (p>0,05), em relação ao ovário com CL. As taxas de prenhez e proporção dos sexos foram semelhantes entre os grupos (p>0,05). A concentração de progesterona (P4) foi diferente entre os grupos, mas não influenciou as variáveis analisadas. A utilização do tratamento hormonal não melhorou os resultados de nenhuma variável. Portanto, o melhor critério de escolha de doadoras Nelore para programas de Produção in vitro (PIV) de embriões é o conhecimento individual de cada animal ao longo das seções de aspiração folicular.
Resumo:
We studied the molecular epidemiology of Staphylococcus aureus strains potentially toxigenic, isolated from the production process of Minas frescal cheese in a small dairy plant in the state of São Paulo. For this, samples were taken during the period from June 2008 to July 2009. Samples were collected from the surface of the receiving and storage tanks of raw milk, the surface of the balance tank of pasteurized milk, the water supply system, the pipes and equipments, the hands of the handler and from the packaged cheese, totaling 140 samples. The colonies isolated on Baird-Parker Agar confirmed as Gram positive and positive for catalase, coagulase and acetoin production, were submitted to extraction of bacterial DNA using the Invitek - Uniscience® kit. Confirmation of the isolated species and enterotoxins SEA, SEB, SEC, SED and TSST-1 toxin was carried out through the amplification of specific fragments of chromosomal DNA. Among the 74 strains of isolated coagulase-positive staphylococci, only 41 (55.4%) strains were confirmed as Staphylococcus aureus, of which 25 (61.0%) were positive to the presence of staphylococcal toxins. The most frequently identified enterotoxin was SEA. The toxigenic strains of Staphylococcus aureus were more frequently isolated from hands of the handler (16.0%), raw milk receiving tank (12.0%), pasteurized milk for cheese making (12.0%) and fresh white cheese ready for consumption (12.0%).
Resumo:
The aim of this study was to evaluate, by means of ultrasound exam, acupuncture effects on uterine involution during the postpartum period in bitches with electroacupuncture. The phenomenon of eutocic uterine involution was studied in 16 bitches, randomly divided into two groups of eight animals each. Group 1 (G1) was treated with electric stimulation (electroacupuncture) of the needle at the points SP6, L3, Bai Hui, TB1, B23, B26, and group 2 (G2), the control group, received treatment in Sham points (placebo points), also with electrical stimuli. The monitoring of the phenomenon of uterine involution was performed by ultrasonography on days 0 (partum), 1, 3, 7 and 14 postpartum. We used SAS statistical analysis method, in order to compare the groups. The results of ultrasound examinations (mean and standard deviations in cm) for the period of observation were as follows: G1: 0.30 ± 0.01 (P), 2.08 ± 0.21 (LU), 4.13 ± 0.23 (DU) and G2: 0.31 ± 0.01 (P) 1.82 ± 0.09 (LU), 3.92 ± 0.11 (DU). We concluded that electroacupuncture affected uterine tone (lasting and uniform at the end of treatment). Electroacupuncture produces a positive tone in the uterus, aiding at the prevention of puerperal diseases.
Resumo:
This study aimed to evaluate the potential of CH4 and CO2 in vitro production of soybean hulls, sunflower meal, corn, citrus pulp and corn silage. Four rumen-cannulated sheep were fed diets containing the evaluated ingredients at 40:60 forage:concentrate ratio. The gases produced by samples incubation were measured by injection into a gas chromatograph equipped with flame ionization detector. The experimental design was completely randomized with repeated measures, with three replicates for each evaluated food at four different periods. Under the experimental conditions, we verified different potential gas production among the ingredients. The citrus pulp meal was the ingredient with the greatest potential for CO2production. Corn silage and soybean hulls showed the greatest potential while citrus pulp and sunflower meal showed the least potential for CH4 production, when expressed in mL/g of degraded dry matter; therefore, they can be considered, among the evaluated ingredients, those with the lowest environmental impact.
Resumo:
The persistence of MCs in aquatic environments and their difficult removal in the conventional water treatment is a challenge to companies of sanitation. However, the MCs are susceptible to degradation by bacteria present in water, sediment and sewage effluents. In this study, we investigated the biodegradation of MCs by microorganism present in carbon filters with biological activity (BAC) and their phylogenetic identification by sequencing gene 16S RNA. A study of water containing MCs was used, with different compositions, plus a filters BAC effluent. The results showed that of MCs were biodegraded by microorganism present in the biofilm. This study provides the ability to complete biodegradation of MCs by bacteria present in BAC filters and the possible use of these microorganisms as alternative of the removal of MCs in the treatment of drinking water
Influence of glyceryl guaiacolate ether on anesthetics in tilapia compared to benzocaine and eugenol
Resumo:
Objective. The study aimed to investigate the effectiveness of glyceryl guaiacolate ether (GGE) and compare the times of induction, recovery, hematological changes, total protein and glycaemia among anesthetics in Nile tilapia, Oreochromis niloticus. Materials and methods. A total of 60 tilapia distributed in 3 aquariums (N=20) were used, which formed the group benzocaine (100 mg/L), eugenol (50 mg/L) and guaiacol glyceryl ether (9.000 mg/L). After the induction of anesthesia fish blood samples were collected to determine the complete hemogram and glycemia. Then the animals were placed in aquariums with running water for assessing the anesthesia recovery. Results. It was verified that GGE showed longer induction and recovery times as well a significant increase (p<0.05) of glycemia, when compared with the other groups (p<0.05). The concentration of total protein did not differ between groups (p>0.05). An increase in the number of monocytes in the group treated with benzocaine (p<0.05) was observed in the analysis of the hematological parameters with no difference between groups for other variables. Conclusions. Eugenol and benzocaine allow rapid induction and recovery in Nile tilapia, without evidence of stress during handling and GGE showed high induction and recovery times, being inadequate for anesthetic use in Nile tilapia.