981 resultados para AMPLIFIED POLYMORPHIC DNA


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Genetic structure of populations of Pissodes castaneus (De Geer) (Coleoptera, Curculionidae) using amplified fragment length polymorphism. The objective of this study was to determine the genetic structure of populations of Pissodes castaneus from different areas and on different species of Pinus using the PCR-AFLP technique. Twenty samples were analyzed, representing 19 populations from Brazil and one from Florence, Italy, which is the region of origin of P. castaneus. The four combinations of primers generated a total of 367 fragments of DNA, and 100% of polymorphic loci, indicating high degree of molecular polymorphism. The dendrogram did not reveal trends for grouping the populations in relation to origin. The low genetic similarity (0.11 between the most distant groups) and genetic distances of 0.13 and 0.44 for 10 out of the 20 samples may indicate several founding events or multiple introductions of heterogeneous strains into Brazil. The allelic fixation index (Fst) was 0.3851, considered high, and the number of migrants (Nm) was 0.3991, indicating low gene flow among populations. The highest genetic distances were between the population from Irani, SC and Cambará do Sul, RS and Bituruna, PR, indicating an independent founding event or a particular allelic fixation in the former location. The high genetic diversity among populations points out that the populations are genetically heterogeneous with a diverse gene pool in the surveyed areas, what makes them to respond differently to control measures.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

We have amplified a (CA)n:(GT)n microsatellite from the TNF promoters of a panel of mouse strains using the polymerase chain reaction. The length of the microsatellites was polymorphic, with eight alleles observed among 15 inbred strains bearing seven distinct H-2 haplotypes, and four outbred strains. In B10 congenic strains, the TNF allele detected by microsatellite polymorphism segregated with the MHC, and in recombinant haplotypes (NOD, NZW), it segregated with H-2D. The TNF allele found in the NZW strain (H-2z) was distinct from those of all other haplotypes, consistent with the hypothesis that this strain may carry a genetic defect in TNF production.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Sequence-Characterized Amplified Region (SCAR) appears as a useful technique for genetic purity testing and variety discrimination, applicable to species in which some other techniques have failed. In particular, this technique is very attractive with species in which RAPD results were not consistent. The RAPD polymorphic bands were cloned, sequenced and from the sequence information, primers pairs for normal PCR were developed. Since the probability of obtaining successful SCAR primers from RAPD polymorphic bands was about 50%, a larger number of RAPD polymorphic bands are needed to develop sufficient SCAR primers for varietal discrimination in vinca. In addition, the efficiency of the SCAR technique is strongly affected by the quality of DNA extracted from seeds. The SCAR banding patterns obtained from vinca seed were consistent and repeatable making the results reliable for genetic purity testing and variety discrimination. The SCAR technique is simple, fast, relatively inexpensive and allows the use of DNA extracted from dry seeds, which is very important in a seed-quality evaluating program

Relevância:

40.00% 40.00%

Publicador:

Resumo:

• Premise of the study: Polymorphic microsatellite markers were developed in Vinca minor (Apocynaceae) to evaluate the level of clonality, population structure, and genetic diversity of the species within its native and introduced range. • Methods and Results: A total of 1371 microsatellites were found in 43,565 reads from 454 pyrosequencing of genomic V. minor DNA. Additional microsatellite loci were mined from publicly available cDNA sequences. After several rounds of screening, 18 primer pairs flanking di-, tri-, or tetranucleotide repeats were identified that revealed high levels of genetic diversity in two native Italian populations, with two to 11 alleles per locus. Clonal growth predominated in two populations from the introduced range in Germany. Five loci successfully cross-amplified in three additional Vinca species. • Conclusions: The novel polymorphic microsatellite markers are promising tools for studying clonality and population genetics of V. minor and for assessing the historical origin of Central European populations.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The Pacific white shrimp, Litopenaeus vannamei (Penaeidae), represents about 95% of all Brazilian shrimp production. The Brazilian L. vannamei foundation broodstock was made up of specimens collected from different American Pacific sites, but little information was collected on the genetic structure of the broodstock. We used the fluorescence amplified fragment length polymorphism (fAFLP) method to study the genetic diversity of L. vannamei broodstock lines 03CMF1 and 03CBF1 originally produced by breeder-shrimps imported mainly from Panama and Ecuador, although wild individuals from other localities may also have been used in producing these two lines. Our results showed a total of 93 polymorphic bands ranging from 50 to 500 bp, the mean Nei's genetic diversity calculated for the total sample was 13.4% and identity and genetic distance analyses indicated high genetic homogeneity within and between both the broodstock lineages studied which suggests that they had similar genetic structure. These results may represent an important tool for the appropriate management of L. vannamei broodstocks. Copyright by the Brazilian Society of Genetics.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The detection of pertinent biomarkers has the potential provide an early indication of disease progression before considerable damage has been incurred. A decrease in an individual’s sensitivity to insulin, which may be quantified as the ratio of insulin to glucose in the blood after a glucose pulse, has recently been reported as an early predictor of insulin-dependent diabetes mellitus. Routine measurement of insulin levels is therefore desirable in the care of diabetes-prone individuals. A rapid, simple, and reagentless method for insulin detection would allow for wide-spread screenings that provide earlier signs of diabetes onset. The aim of this thesis is to develop a folding-base electrochemical sensor for the detection of insulin. The sensor described herein consists of a DNA probe immobilized on a gold disc electrode via an alkanethiol linker and embedded in an alkanethiol self-assembled monolayer. The probe is labeled with a redox reporter, which readily transfers electrons to the gold electrode in the absence of insulin. In the presence of insulin, electron transfer is inhibited, presumably due to a binding-induced conformational or dynamic change in the DNA probe that significantly alters the electron-tunneling pathway. A 28-base segment of the insulin-linked polymorphic region that has been reported to bind insulin with high affinity serves as the capture element of the DNA probe. Three probe constructs that vary in their secondary structure and position of the redox label are evaluated for their utility as insulin-sensing elements on the electrochemical platform. The effects of probe modification on secondary structure are also evaluated using circular dichroism spectroscopy.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Canine granulocytic anaplasmosis (CGA) is caused by the rickettsial microorganism Anaplasma phagocytophilum. CGA is typically characterized by fever, thrombocytopenia, lethargy, anorexia, arthropy, and other nonspecific clinical signs. Skin lesions have been described in naturally infected lambs and humans. The pathophysiology of CGA is not entirely clear, and the persistence of the organism after the resolution of clinical signs has been described. The aim of the study was to investigate if A. phagocytophilum can be detected in canine lesional skin biopsies from A. phagocytophilum-seropositive dogs with etiologically unclear skin lesions that improved after the treatment with doxycycline. Paraffin-embedded lesional skin biopsies were allocated into separate groups: biopsies from A. phagocytophilum-seropositive dogs responsive to treatment with doxycycline (n=12), biopsies from A. phagocytophilum-seronegative dogs (n=2), and biopsies in which skin lesions histopathologically resembled a tick bite (n=10). The serological status of the latter group was unknown. Histology of the seropositive and seronegative dog skin lesions did not indicate an etiology. DNA was extracted, and a conventional PCR for partial 16S rRNA gene was performed. Anaplasma phagocytophilum DNA was amplified from 4/12 seropositive dogs' skin biopsies. All sequences were 100% identical to the prototype A. phagocytophilum human strain (GenBank accession number U02521). Anaplasma phagocytophilum was not amplified from the 2 seronegative and 10 suspected tick bite dogs. Serum antibody titers of the PCR-positive dogs ranged from 1:200 to 1:2048. Histopathologically, a mild-to-moderate perivascular to interstitial dermatitis composed of a mixed cellular infiltrate and mild-to-moderate edema was seen in all seropositive dogs. In 8/12 seropositive dogs, vascular changes as vasculopathy, fibrinoid necrosis of the vessel walls, and leukocytoclastic changes were observed. In summary, our results support the hypothesis that the persistence of A. phagocytophilum in the skin may be causative for otherwise unexplained skin lesions in seropositive dogs.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A computational system for the prediction of polymorphic loci directly and efficiently from human genomic sequence was developed and verified. A suite of programs, collectively called pompous (polymorphic marker prediction of ubiquitous simple sequences) detects tandem repeats ranging from dinucleotides up to 250 mers, scores them according to predicted level of polymorphism, and designs appropriate flanking primers for PCR amplification. This approach was validated on an approximately 750-kilobase region of human chromosome 3p21.3, involved in lung and breast carcinoma homozygous deletions. Target DNA from 36 paired B lymphoblastoid and lung cancer lines was amplified and allelotyped for 33 loci predicted by pompous to be variable in repeat size. We found that among those 36 predominately Caucasian individuals 22 of the 33 (67%) predicted loci were polymorphic with an average heterozygosity of 0.42. Allele loss in this region was found in 27/36 (75%) of the tumor lines using these markers. pompous provides the genetic researcher with an additional tool for the rapid and efficient identification of polymorphic markers, and through a World Wide Web site, investigators can use pompous to identify polymorphic markers for their research. A catalog of 13,261 potential polymorphic markers and associated primer sets has been created from the analysis of 141,779,504 base pairs of human genomic sequence in GenBank. This data is available on our Web site (pompous.swmed.edu) and will be updated periodically as GenBank is expanded and algorithm accuracy is improved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Simple sequence repeats (SSRs), consisting of tandemly repeated multiple copies of mono-, di-, tri-, or tetranucleotide motifs, are ubiquitous in eukaryotic genomes and are frequently used as genetic markers, taking advantage of their length polymorphism. We have examined the polymorphism of such sequences in the chloroplast genomes of plants, by using a PCR-based assay. GenBank searches identified the presence of several (dA)n.(dT)n mononucleotide stretches in chloroplast genomes. A chloroplast (cp) SSR was identified in three pine species (Pinus contorta, Pinus sylvestris, and Pinus thunbergii) 312 bp upstream of the psbA gene. DNA amplification of this repeated region from 11 pine species identified nine length variants. The polymorphic amplified fragments were isolated and the DNA sequence was determined, confirming that the length polymorphism was caused by variation in the length of the repeated region. In the pines, the chloroplast genome is transmitted through pollen and this PCR assay may be used to monitor gene flow in this genus. Analysis of 305 individuals from seven populations of Pinus leucodermis Ant. revealed the presence of four variants with intrapopulational diversities ranging from 0.000 to 0.629 and an average of 0.320. Restriction fragment length polymorphism analysis of cpDNA on the same populations previously failed to detect any variation. Population subdivision based on cpSSR was higher (Gst = 0.22, where Gst is coefficient of gene differentiation) than that revealed in a previous isozyme study (Gst = 0.05). We anticipate that SSR loci within the chloroplast genome should provide a highly informative assay for the analysis of the genetic structure of plant populations.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The rat cell line REF52 is not permissive for gene amplification. Simian virus 40 tumor (T) antigen converts these cells to a permissive state, as do dominant negative mutants of p53, suggesting that the effect of T antigen is due mainly to its ability to bind to p53. To manipulate permissivity, we introduced a temperature-sensitive mutant of T antigen (tsA58) into REF52 cells and selected for resistance to N-(phosphonacetyl)-L-aspartate (PALA). Most freshly isolated PALA-resistant colonies, each of approximately 200 cells, selected at a permissive temperature, arrested when shifted to a nonpermissive temperature. Growth arrest was stable, with no evidence of apoptosis, as long as T antigen was absent but was reversed when T antigen was restored. In contrast, PALA-resistant clones grown to approximately 10(7) cells at a permissive temperature did not arrest when shifted to a nonpermissive temperature. All PALA-resistant clones examined had amplified carbamoyl-phosphate synthetase-aspartate transcarbamoylase-dihydroorotase (CAD) genes, present in structures consistent with a mechanism involving bridge-breakage-fusion (BBF) cycles. We propose that p53-mediated growth arrest operates only early during the complex process of gene amplification, when newly formed PALA-resistant cells contain broken DNA, generated in BBF cycles. During propagation under permissive conditions, the broken DNA ends are healed, and, even though the p53-mediated pathway is still intact at a nonpermissive temperature and the cells contain amplified DNA, they are not arrested in the absence of broken DNA. The data support the hypothesis that BBF cycles are an important mechanism of amplification and that the broken DNA generated in each cycle is a key signal that regulates permissivity for gene amplification.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

During infections, Giardia lamblia undergoes a continuous change of its major surface antigens, the variant-specific surface proteins (VSPs). Many studies on antigenic variation have been performed using G. lamblia clone GS/M-83-H7, which expresses surface antigen VSP H7. The present study was focused on the identification and characterization of vsp gene sequences within the genome of the clonal G. lamblia GS/M-83-H7 line. For this purpose, we applied a PCR which specifically amplified truncated sequences from the 3'-terminal region of the vsp genes. Upon cloning, most of the vsp gene amplification products were shown to be approximately identical in size and thus could not be distinguished from each other by conventional gel electrophoresis. In order to pre-estimate the sequence complexity within the large panel of vsp clones isolated, we elaborated a novel concept which facilitated our large-scale genetic screening approach: PCR products from cloned DNA molecules were generated and then subjected to a DNA melting profile assay based on the use of the LightCycler Instrument. This high-throughput assay system proved to be well suited to monitor sequence differences between the amplification products from closely related vsp genes and thus could be used for the primary, sequence-related discrimination of the corresponding clones. After testing 50 candidates, vsp clones could be divided into five groups, each characterized by an individual DNA melting profile of the corresponding amplification products. Sequence analysis of some of these 50 candidates confirmed data from the aforementioned assay in that clones were demonstrated to be identical within, but different between, the distinct groups. The nucleotide and deduced amino acid sequences of five representative vsp clones showed high similarities both among each other and also with the corresponding gene segment of the variant-specific surface antigen (VSP H7) expressed by the original GS/M-83-H7 variant type. Furthermore, three of the genomic vsp sequences turned out to be identical to vsp sequences that represented previously characterized transcription products from in vivo- or in vitro-switched GS/M-83-H7 trophozoites. In conclusion, the DNA melting profile assay seems to be a versatile tool for the PCR-based genotyping of moderately or highly diversified sequence orthologues.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To detect the presence of male DNA in vaginal samples collected from survivors of sexual violence and stored on filter paper. A pilot study was conducted to evaluate 10 vaginal samples spotted on sterile filter paper: 6 collected at random in April 2009 and 4 in October 2010. Time between sexual assault and sample collection was 4-48hours. After drying at room temperature, the samples were placed in a sterile envelope and stored for 2-3years until processing. DNA extraction was confirmed by polymerase chain reaction for human β-globin, and the presence of prostate-specific antigen (PSA) was quantified. The presence of the Y chromosome was detected using primers for sequences in the TSPY (Y7/Y8 and DYS14) and SRY genes. β-Globin was detected in all 10 samples, while 2 samples were positive for PSA. Half of the samples amplified the Y7/Y8 and DYS14 sequences of the TSPY gene and 30% amplified the SRY gene sequence of the Y chromosome. Four male samples and 1 female sample served as controls. Filter-paper spots stored for periods of up to 3years proved adequate for preserving genetic material from vaginal samples collected following sexual violence.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Restriction fragment length polymorphism (RFLP) is a common molecular assay used for genotyping, and it requires validated quality control procedures to prevent mistyping caused by impaired endonuclease activity. We have evaluated the usefulness of a plasmid-based internal control in RFLP assays. Results: Blood samples were collected from 102 individuals with acute myocardial infarction (AMI) and 108 non-AMI individuals (controls) for DNA extraction and laboratory analyses. The 1196C> T polymorphism in the toll-like receptor 4 (TLR4) gene was amplified by mismatched-polymerase chain reaction (PCR). Amplicons and pBluescript II SK-plasmid were simultaneously digested with endonuclease HincII. Fragments were separated on 2% agarose gels. Plasmid was completely digested using up to 55.2 nmL/L DNA solutions and 1 mu L PCR product. Nevertheless, plasmid DNA with 41.4 nM or higher concentrations was incompletely digested in the presence of 7 mL PCR product. In standardized conditions, TLR4 1196C> T variant was accurately genotyped. TLR4 1196T allele frequency was similar between AMI (3.1%) and controls (2.0%, p = 0.948). TLR4 SNP was not associated with AMI in this sample population. In conclusion, the plasmid-based control is a useful approach to prevent mistyping in RFLP assays, and it is validate for genetic association studies such as TLR4 1196C> T.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).