Estudo das catelicidinas no plasma seminal de garanhões e das interleucinas na resposta inflamatória pós-iseminação artificial em éguas

Pós-graduação em Medicina Veterinária - FMVZ

Criopreservação e fertilidade de espermatozoides do ejaculado e recuperados da cauda do epidídimo de garanhões subférteis

Pós-graduação em Medicina Veterinária - FMVZ

Efeitos da sexagem por citometria de fluxo sobre a composição protéica da membrana de espermatozóides bovinos

Pós-graduação em Medicina Veterinária - FMVZ

Efeito do flushing sobre o desempenho reprodutivo de ovelhas Morada Nova e Santa Inês submetidas à inseminação artificial em tempo fixo

The aim of this study was to analyze the effect of flushing on the reproductive performance of Morada Nova (MN) and Santa Inês (SI) ewes submitted to fixed time artificial insemination (TAI). Twenty seven SI and 24 MN supplemented with concentrate (1% of live weight, on average), for 75 days during the breeding season. After 30 days of supplementation, ewes were synchronized with the aid of a hormonal protocol (HP) based on progesterone, eCG and cloprostenol. The estrus observation was conducted at 12, 24, 36 and 48 h after the end of HP with the aid of two ruffians. TAI was done 55 h after the end of HP. From 20 to 45 days after the beginning of the HP ewes were exposed to rams (natural breeding). The pregnancy diagnosis was evaluated 70 days after TAI. We analyzed the weight, body condition score, estrus rate, pregnancy rate and prolificacy testing the effects of race, week of supplementation and body condition score class. The weight and body conditions of ewes varied according to the week of supplementation, with higher values in the first two weeks following TAI. The estrus rate was 88.2% and 43.2% of the ewes showed estrus up to 24 hours of the end of the HP. The pregnancy rate per TAI was 31.3% and the pregnancy rate after natural breeding was 50.0%. It was observed that body condition score classes interfered in pregnancy rates. There was a higher percentage of multiple births by pregnancy by TAI than by natural breeding. It was concluded that the flushing resulted in weight gain and better body conditions ensuring the standardization of the herd for breeding season, which therefore improved reproductive performance. The HP used advanced the onset of estrus and increased prolificacy, but was inefficient in the synchronization of woolless sheep.

Reproductive parameters of dairy goats submitted to estrus synchronization with prostaglandin F2α associated or not to hCG at estrous onset

O objetivo deste estudo foi avaliar a eficiência do uso de duas doses de PGF associadas ou não à administração de hCG no início do estro sobre os parâmetros reprodutivos de cabras leiteiras. Um total de 29 cabras receberam duas doses de 30 µg d-cloprostenol pela via latero-vulvar com 10 dias de intervalo (Dia 1 e Dia 10). As cabras foram alocadas para receberem o hCG (250 IU) ou salina i.m. no momento em que o estro foi detectado. Depois da realização da segunda dose de PGF, o estro foi monitorado e exames ultrassonográficos foram realizados duas vezes ao dia. Todas as fêmeas foram inseminadas 16 h após o inicio do estro. Amostras de sangue foram coletadas diariamente para determinação das concentrações plasmáticas de progesterona. O uso do hCG no momento do início do estro não afetou os parâmetros estudados e, portanto, os dados serão apresentados agrupados. A taxa de manifestação de estro foi similar (P > 0,05) na primeira (75,9% - 22/29) ou na segunda dose de PGF (79,3% - 23/29). O intervalo entre a administração de PGF e o início do estro foi maior (P < 0,05) no Dia 1 (75,8±53,9 h) que no Dia 10 (47,7±10,1 h). Duração do estro também diferiu (P < 0,05) 35,4±15,9 (Dia 1) vs 26,8±15, 0 h (Dia 10). A taxa de ovulação foi 79,3% (23/29) após a segunda dose PGF. Não foi encontrada diferença (P>0,05) entre os grupos experimentais quanto aos parâmetros reprodutivos: intervalo entre a aplicação da segunda dose e a ovulação (86,6±11,4h), intervalo do estro a ocorrência da ovulação (39,9±12,3h), diâmetro do maior folículo (7,2±1,4) e número de ovulações (1,8±0,6). No Dia 1, 52,4% (11/21) apresentavam concentrações de progesterona < 1 ng/mL. No Dia 10, 100% dos animais apresentavam concentrações >1ng/mL. O presente estudo permite concluir que o estro pode ser eficientemente sincronizado em cabras leiteiras com duas doses de PGF intervaladas em 10 dias. Novas pesquisas devem se realizadas para avaliar diferentes doses e momentos de utilização do hCG.

Avanços na criopreservação do sêmen ovino I: diluidores e crioprotetores

The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Aspectos reprodutivos, morfologia dos gametas e desenvolvimento embrionário de Astyanax altiparanae Garutti & Britski (Teleostei, Characidae)

Pós-graduação em Aquicultura - FCAV

Análise de parâmetros espermáticos e fertilidade de ratos Wistar expostos ao interferon alfa

Pós-graduação em Biologia Geral e Aplicada - IBB

Embriões bovinos produzidos in vitro com espermatozoides sexados por citometria de fluxo: avaliação do desenvolvimento embrionário e da expressão de genes candidatos ao reconhecimento da gestação

Pós-graduação em Genética e Melhoramento Animal - FCAV

Resposta luteal à PGF2α (Dinoprost Trometamina) durante as fases de luteogênese e manutenção do corpo lúteo em éguas

Pós-graduação em Medicina Veterinária - FMVZ

Inducing ovulation early postpartum influences uterine health and fertility in dairy cows

The objective of the current study was to evaluate the effect of GnRH early postpartum on induction of ovulation, uterine health, and fertility in dairy cows. Holstein cows without a corpus luteum (CL) at 17 +/- 3 DIM were assigned randomly to receive i.m. GnRH (n = 245) at 17 +/- 3 and 20 +/- 3 DIM or remain as controls (n = 245). Ovaries were scanned by ultrasonography twice weekly totaling 4 examinations. Ovulation was characterized by the appearance of a CL >= 20 mm at any ultrasound or CL <20 mm in 2 consecutive examinations. Clinical and cytological endometritis were diagnosed at 35 DIM. Compared with control, GnRH increased ovulation up to 3.5 d after the last treatment (78.7 vs. 45.0%) and did not affect the prevalence of clinical endometritis (23.9 vs. 18.6%) or cytological endometritis (30.9 vs. 32.8%). Prevalence of clinical endometritis increased in cows that had calving problems (32.6 vs. 15.9%) and metritis (40.6 vs. 15.8%). Metritis increased prevalence of cytological endometritis (50.7 vs. 23.5%). Treatment with GnRH did not affect pregnancy per artificial insemination at 32 (37.6 vs. 38.6%) or 74 d after artificial insemination (35.0 vs. 31.5%), but reduced pregnancy loss (6.8 vs. 18.1%). No overall effect of GnRH treatment on hazard of pregnancy was observed; however, an interaction between GnRH treatment and ovulation showed that GnRH-treated cows that ovulated had increased hazard of pregnancy by 300 DIM compared with GnRH-treated and control cows that did not ovulate (hazard ratio = 2.0 and 1.3, respectively), but similar to control cows that ovulated (hazard ratio = 1.1). Gonadotropin-releasing hormone early postpartiim induced ovulation without affecting uterine health, but failed to improve pregnancy per artificial insemination or time to pregnancy, although it reduced pregnancy loss.

Relationships between growth of the preovulatory follicle and gestation success in lactating dairy cows

This report summarizes three studies conducted with lactating dairy cows aiming to increase pregnancy rates to fixed time artificial insemination (TAI) protocols. Experiment 1 was designed to determine if changing the timing of PGF2 alpha treatment during an E2/P4-based program would affect fertility to TAI or fixed-time embryo transfer (TET). In experiment 2, pregnancy rates to AI were compared following synchronized ovulation using two protocols that have been developed to reduce the period between follicular wave emergence and TAI. The Ovsynch-type protocol utilizes GnRH to synchronize the follicular wave by inducing ovulation of a dominant follicle at the beginning of the protocol, and to synchronize ovulation at the end of the protocol allowing TAI. In contrast, E2/P4-based protocols utilize E2 products in the presence of P4 to induce atresia of antral follicles and synchronize emergence of a new follicular wave. At the end of E2/P4-based protocol another E2 treatment in the absence of P4 is used to induce LH release and synchronize ovulation and allow TAI. Experiment 3 was designed to determine whether increasing the length time interval with reduced circulating P4 (proestrus) would increase fertility in a TAI program that utilized E2 and P4 to synchronize ovulation of cycling, lactating dairy cows. The overall conclusions are that circulating concentrations of progesterone and estradiol prior to and circulating concentrations of progesterone following ovulation can affect fertility in cattle. In addition, small increases in P4 concentrations near the time of AI, due to lack of complete CL regression, result in reductions in fertility. Earlier treatment with PGF2 alpha should allow greater time for CL regression, an increase in estradiol and subsequent reductions in circulating P4 that could be critical for fertility. Optimization of follicle size in TAI programs is clearly an intricate balance between oocyte quality, adequate circulating E2 near AI, and adequate circulating P4 after AI.

Impacts of Reproductive Technologies on Beef Production in South America

The majority of beef cow herds in South America are constituted by Bos indicus females, which have particular reproductive features that contribute to reduced reproductive efficiency compared with that of B. taurus cohorts. Hence, several alternatives to enhance reproductive efficiency of B. indicus heifers and cows have been developed to address their inherent reproductive shortcomings. These research-based technologies are being described in detail within this chapter and have already made an impact on South American B. indicus-based production systems. These include the following: (a) hormonal protocols to induce puberty in nulliparous heifers or estrous cyclicity in postpartum cows to maximize their reproductive performance during the subsequent breeding season, (b) hormonal protocols to synchronize estrus and/or ovulation in B. indicus females to exploit their reproductive responses to artificial insemination, and (c) genetic and environmental factors that influence reproductive success in beef herds, including reproductive diseases and excitable temperament of B. indicus females, that have been investigated to support/promote the development of appropriate mitigation technologies.

Assessment of in vitro sperm characteristics and their importance in the prediction of conception rate in a bovine timed-AI program

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)