945 resultados para human factor
Resumo:
Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.
Resumo:
Human hookworm infection is a major cause of gastrointestinal blood loss and iron deficiency anemia, affecting up to one billion people in the developing world. These soil-transmitted helminths cause blood loss during attachment to the intestinal mucosa by lacerating capillaries and ingesting extravasated blood. We have isolated the major anticoagulant used by adult worms to facilitate feeding and exacerbate intestinal blood loss. This 8.7-kDa peptide, named the Ancylostoma caninum anticoagulant peptide (AcAP), was purified by using a combination of ion-exchange chromatography, gel-filtration chromatography, and reverse-phase HPLC. N-terminal sequencing of AcAP reveals no homology to any previously identified anticoagulant or protease inhibitor. Single-stage chromogenic assays reveal that AcAP is a highly potent and specific inhibitor of human coagulation, with an intrinsic K*i for the inhibition of free factor Xa of 323.5 pM. In plasma-based clotting time assays, AcAP was more effective at prolonging the prothrombin time than both recombinant hirudin and tick anticoagulant peptide. These data suggest that AcAP, a specific inhibitor of factor Xa, is one of the most potent naturally occurring anticoagulants described to date.
Resumo:
We used a bacterially expressed fusion protein containing the entire cytoplasmic domain of the human leukemia inhibitory factor (LIF) receptor to study its phosphorylation in response to LIF stimulation. The dose- and time-dependent relationships for phosphorylation of this construct in extracts of LIF-stimulated 3T3-L1 cells were superimposable with those for the stimulation of mitogen-activated protein kinase (MAPK). Indeed, phosphorylation of the cytoplasmic domain of the low-affinity LIF receptor alpha-subunit (LIFR) in Mono Q-fractionated, LIF-stimulated 3T3-L1 extracts occurred only in those fractions containing activated MAPK; Ser-1044 served as the major phosphorylation site in the human LIFR for MAPK both in agonist-stimulated 3T3-L1 lysates and by recombinant extracellular signal-regulated kinase 2 in vitro. Expression in rat H-35 hepatoma cells of LIFR or chimeric granulocyte-colony-stimulating factor receptor (G-CSFR)-LIFR mutants lacking Ser-1044 failed to affect cytokine-stimulated expression of a reporter gene under the control of the beta-fibrinogen gene promoter but eliminated the insulin-induced attenuation of cytokine-stimulated gene expression. Thus, our results identify the human LIFR as a substrate for MAPK and suggest a mechanism of heterologous receptor regulation of LIFR signaling occurring at Ser-1044.
Resumo:
mac25, the subject of this report, was selected by the differential display of mRNA method in a search for genes overexpressed in senescent human mammary epithelial cells. mac25 had previously been cloned as a discrete gene, preferentially expressed in normal, leptomeningial cells compared with meningioma tumors. mac25 is another member of the insulin growth factor-binding protein (IGFBP) family. Insulin-like growth factors are potent mitogens for mammary epithelial cells, and the IGFBPs have been shown to modulate this mitogenic activity. We report here that mac25, unlike most IGFBPs, is down-regulated at the transcription level in mammary carcinoma cell lines, suggesting a tumor-suppressor role. The gene was mapped to chromosome 4q12. We found that mac25 accumulates in senescent cells and is up-regulated in normal, growing mammary epithelial cells by all-trans-retinoic acid or the synthetic retinoid fenretinide. These findings suggest that mac25 may be a downstream effector of retinoid chemoprevention in breast epithelial cells and that its tumor-suppressive role may involve a senescence pathway.
Resumo:
We investigated the influence of interferons alpha, beta, and gamma (IFN-alpha, -beta, and -gamma) on the production of basic fibroblast growth factor (bFGF) by human renal carcinoma cells. The human renal carcinoma cell metastatic line SN12PM6 was established in culture from a lung metastasis and SN12PM6-resistant cells were selected in vitro for resistance to the antiproliferative effects of IFN-alpha or IFN-beta. IFN-alpha and IFN-beta, but not IFN-gamma, down-regulated the expression of bFGF at the mRNA and protein levels by a mechanism independent of their antiproliferative effects. Down-regulation of bFGF required a long exposure (> 4 days) of cells to low concentrations (> 10 units/ml) of IFN-alpha or IFN-beta. The withdrawal of IFN-alpha or IFN-beta from the medium permitted SN12PM6-resistant cells to resume production of bFGF. The incubation of human bladder, prostate, colon, and breast carcinoma cells with noncytostatic concentrations of IFN-alpha or IFN-beta also produced down-regulation of bFGF production.
Resumo:
The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.
Resumo:
RB, the protein product of the retinoblastoma tumor-suppressor gene, regulates the activity of specific transcription factors. This regulation appears to be mediated either directly through interactions with specific transcription factors or through an alternative mechanism. Here we report that stimulation of Sp1-mediated transcription by RB is partially abrogated at the nonpermissive temperature in ts13 cells. These cells contain a temperature-sensitive mutation in the TATA-binding protein-associated factor TAFII250, first identified as the cell cycle regulatory protein CCG1. The stimulation of Sp1-mediated transcription by RB in ts13 cells at the nonpermissive temperature could be restored by the introduction of wild-type human TAFII250. Furthermore, we demonstrate that RB binds directly to hTAFII250 in vitro and in vivo. These results suggest that RB can confer transcriptional regulation and possibly cell cycle control and tumor suppression through an interaction with TFIID, in particular with TAFII250.
Resumo:
The human general transcription factor TFIIA is one of several factors involved in specific transcription by RNA polymerase II, possibly by regulating the activity of the TATA-binding subunit (TBP) of TFIID. TFIIA purified from HeLa extracts consists of 35-, 19-, and 12-kDa subunits. Here we describe the isolation of a cDNA clone (hTFIIA gamma) encoding the 12-kDa subunit. Using expression constructs derived from hTFIIA gamma and TFIIA alpha/beta (which encodes a 55-kDa precursor to the alpha and beta subunits of natural TFIIA), we have constructed a synthetic TFIIA with a polypeptide composition similar to that of natural TFIIA. The recombinant complex supports the formation of a DNA-TBP-TFIIA complex and mediates both basal and Gal4-VP16-activated transcription by RNA polymerase II in TFIIA-depleted nuclear extracts. In contrast, TFIIA has no effect on tRNA and 5S RNA transcription by RNA polymerase III in this system. We also present evidence that both the p55 and p12 recombinant subunits interact with TBP and that the basic region of TBP is critical for the TFIIA-dependent function of TBP in nuclear extracts.
Resumo:
Antisense oligodeoxyribonucleotides targeted to the epidermal growth factor (EGF) receptor were encapsulated into liposomes linked to folate via a polyethylene glycol spacer (folate-PEG-liposomes) and efficiently delivered into cultured KB cells via folate receptor-mediated endocytosis. The oligonucleotides were a phosphodiester 15-mer antisense to the EGF receptor (EGFR) gene stop codon (AEGFR2), the same sequence with three phosphorothioate linkages at each terminus (AEGFR2S), a randomized 15-mer control of similar base composition to AEGFR2 (RC15), a 14-mer control derived from a symmetrized Escherichia coli lac operator (LACM), and the 5'-fluorescein-labeled homologs of several of the above. Cellular uptake of AEGFR2 encapsulated in folate-PEG-liposomes was nine times higher than AEGFR2 encapsulated in nontargeted liposomes and 16 times higher than unencapsulated AEGFR2. Treatment of KB cells with AEGFR2 in folate-PEG-liposomes resulted in growth inhibition and significant morphological changes. Curiously, AEGFR2 and AEGFR2S encapsulated in folate-PEG-liposomes exhibited virtually identical growth inhibitory effects, reducing KB cell proliferation by > 90% 48 hr after the cells were treated for 4 hr with 3 microM oligonucleotide. Free AEGFR2 caused almost no growth inhibition, whereas free AEGFR2S was only one-fifth as potent as the folate-PEG-liposome-encapsulated oligonucleotide. Growth inhibition of the oligonucleotide-treated cells was probably due to reduced EGFR expression because indirect immunofluorescence staining of the cells with a monoclonal antibody against the EGFR showed an almost quantitative reduction of the EGFR in cells treated with folate-PEG-liposome-entrapped AEGFR2. These results suggest that antisense oligonucleotide encapsulation in folate-PEG-liposomes promise efficient and tumor-specific delivery and that phosphorothioate oligonucleotides appear to offer no major advantage over native phosphodiester DNA when delivered by this route.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Liver X receptors (LXRs) are ligand-activated members of the nuclear receptor superfamily that regulate the expression of genes involved in lipid metabolism and inflammation, although their role in inflammation and immunity is less well known. It has been reported that oxysterols/LXRs may act as anti-inflammatory molecules, although opposite actions have also been reported. In this study, we investigated the effect of platelet-activating factor (PAF), a proinflammatory molecule, on LXRα signalling in human neutrophils. We found that PAF exerted an inhibitory effect on mRNA expression of TO901317-induced LXRα, ATP-binding cassette transporter A1, ATP-binding cassette transporter G1, and sterol response element binding protein 1c. This negative action was mediated by the PAF receptor, and was dependent on the release of reactive oxygen species elicited by PAF, as it was enhanced by pro-oxidant treatment and reversed by antioxidants. Current data also support the idea that PAF induces phosphorylation of the LXRα molecule in an extracellular signal-regulated kinase 1/2-mediated fashion. These results suggest that a possible mechanism by which PAF exerts its proinflammatory effect is through the downregulation of LXRα and its related genes, which supports the notion that LXRα ligands exert a modulatory role in the neutrophil-mediated inflammatory response.
Resumo:
Mode of access: Internet.
Resumo:
Obesity, with its related problems, is recognized as the fastest growing disease epidemic facing the world, yet we still have limited insight into the regulation of adipose tissue mass in humans. We have previously shown that adipose-derived microvascular endothelial cells (MVECs) secrete a factor(s) that increases proliferation of human preadipocytes. We now demonstrate that coculture of human preadipocytes with MVECs significantly increases preadipocyte differentiation, evidenced by dramatically increased triacylglycerol accumulation and glycerol-3-phosphate dehydrogenase activity compared with controls. Subsequent analysis identified fibroblast growth factor (FGF)-1 as an adipogenic factor produced by MVECs. Expression of FGF-1 was demonstrated in MVECs but not in preadipocytes, while preadipocytes were shown to express FGF receptors 1-4. The proliferative effect of MVECs on human preadipocytes was blocked using a neutralizing antibody specific for FGF-1. Pharmacological inhibition of FGF-1 signaling at multiple steps inhibits preadipocyte replication and differentiation, supporting the key adipogenic role of FGF-1. We also show that 3T3-L1 cells, a highly efficient murine model of adipogenesis, express FGF-1 and, unlike human preadipocytes, display no increased differentiation potential in response to exogenous FGF-1. Conversely, FGF-1-treated human preadipocytes proliferate rapidly and differentiate with high efficiency in a manner characteristic of 3T3-L1 cells. We therefore suggest that FGF-1 is a key human adipogenic factor, and these data expand our understanding of human fat tissue growth and have significant potential for development of novel therapeutic strategies in the prevention and management of human obesity.
Resumo:
Despite more than a 10-fold increase in T cell numbers in G-CSF-mobilized peripheral blood stem cell (PBSC) grafts, incidence and severity of acute graft-vs-host disease (GVHD) are comparable to bone marrow transplantation. As CD1d-restricted, Valpha24(+)Vbeta11(+) NKT cells have pivotal immune regulatory functions and may influence GVHD, we aimed to determine whether G-CSF has any effects on human NKT cells. In this study, we examined the frequency and absolute numbers of peripheral blood NKT cells in healthy stem cell donors (n = 8) before and following G-CSF (filgrastim) treatment. Effects of in vivo and in vitro G-CSF on NKT cell cytokine expression profiles and on responsiveness of NKT cell subpopulations to specific stimulation by alpha-galactosylceramide (alpha-GalCer) were assessed. Contrary to the effects on conventional T cells, the absolute number of peripheral blood NKT cells was unaffected by G-CSF administration. Furthermore, responsiveness of NKT cells to alpha-GalCer stimulation was significantly decreased (p < 0.05) following exposure to G-CSF in vivo. This hyporesponsiveness was predominantly due to a direct effect on NKT cells, with a lesser contribution from G-CSF-mediated changes in APC. G-CSF administration resulted in polarization of NKT cells toward a Th2, IL-4-secreting phenotype following alpha-GalCer stimulation and preferential expansion of the CD4(+) NKT cell subset. We conclude that G-CSF has previously unrecognized differential effects in vivo on NKT cells and conventional MHC-restricted T cells, and effects on NKT cells may contribute to the lower than expected incidence of GVHD following allogeneic peripheral blood stem cell transplantation.
Resumo:
The AP-2 transcription factor family is presumed to play an important role in the regulation of the keratinocyte squamous differentiation program; however, limited functional data are available to support this. In the present study, the activity and regulation of AP-2 were examined in differentiating human epidermal keratinocytes. We report that (1) AP-2 transcriptional activity decreases in differentiated keratinocytes but remains unchanged in differentiation-insensitive squamous cell carcinoma cell lines, (2) diminished AP-2 transcriptional activity is associated with a loss of specific DNA-bound AP-2 complexes, and (3) there is an increase in the ability of cytoplasmic extracts, derived from differentiated keratinocytes, to phosphorylate AP-2alpha and AP-2beta when cells differentiate. In contrast, extracts from differentiation-insensitive squamous cell carcinoma cells are unable to phosphorylate AP-2 proteins. Finally, the phosphorylation of recombinant AP-2alpha by cytosolic extracts from differentiated keratinocytes is associated with decreased AP-2 DNA-binding activity. Combined, these data indicate that AP-2 trans-activation and DNA-binding activity decrease as keratinocytes differentiate, and that this decreased activity is associated with an enhanced ability to phosphorylate AP-2alpha and beta.