Bcl-2 expression and apoptosis induction in human HL60 leukaemic cells treated with a novel organotellurium(IV) compound RT-04

Organotellurium(]V) compounds have been reported to have multiple biological activities including cysteine protease-inhibitory activity, mainly cathepsin B. As cathepsin B is a highly predictive indicator for prognosis and diagnosis of cancer, a possible antitumor potential for these new compounds is expected. In this work, it was investigated the effectiveness of organotellurium(IV) RT-04 to produce lethal effects in the human promyelocytic leukaemia cell line HL60. Using the MTT tetrazolium reduction test, and trypan blue exclusion assay, the IC50 for the compound after 24 h incubation was 6.8 and 0.35 mu M, respectively. Moreover, the compound was found to trigger apoptosis in HL60 cells, inducing DNA fragmentation and caspase-3, -6, and -9 activations. The apoptsosis-induced by RT-04 is probably related to the diminished Bcl-2 expression, observed by RT-PCR, in HL60-treated cells. In vivo studies demonstrated that the RT-04 treatment (2.76 mg/kg given for three consecutive days) produces no significant toxic effects for bone marrow and spleen CFU-GM. However, higher doses (5.0 and 10 mg/kg) produced a dose-dependent reduction in the number of CFU-GM of RT-04-treated mice. These results suggest that RT-04 is able to induce apoptosis in HL60 cells by Bcl-2 expression down-modulation. Further studies are necessary to better clarify the effects of this compound on bone marrow normal cells. (C) 2008 Elsevier Ltd. All rights reserved.

Öppna test jämfört med blindtest : Hur påverkas lyssnarens bedömning?

Denna undersökning söker ett svar på hur den relativt vana lyssnarens bedömning av ljudkvalitet påverkas av ett så kallat öppet test, där det som bedöms är känd för lyssnaren, jämfört med ett blindtest, där detta objekt är okänt. Frågan appliceras på kvalitetsbedömningen av digitala kodningstekniker, d.v.s. hur lyssnaren påverkas av att valet av kodningsteknik som avlyssnas är känd eller inte. För att ta reda på detta genomfördes ett lyssningstest med nio deltagare. Deltagarna fick betygssätta perceptuellt kodade ljudfiler mot en känd referens, både som ett blindtest samt i ett öppet test. Resultatet är mångtydigt och inga generella slutsatser för hur lyssnaren påverkas av ett öppet test jämfört med ett blindtest går att uppfatta. Resultatet visar dock att påverkan ett öppet test har på lyssnarens bedömning är högst individuell. Lyssningstest i form av blindtest bör därför användas för att uppnå pålitligast resultat. 

Caracterização parcial de um fragmento e detecção por RT-PCR de Rice Stripe Necrosis Virus

O enrolamento do arroz é uma doença viral emergente no Brasil causada pelo Rice stripe necrosis virus (RSNV) que é transmitido pelo protozoário Polymyxa graminis. RSNV é um membro do gênero Benyvirus com genoma dividido em 4 RNAs de fita simples no sentido positivo (ssRNA +). Em função da falta de conhecimento sobre a seqüência de nucleotídeos do seu genoma, a detecção de RSNV através de métodos moleculares não é utilizada. O objetivo deste trabalho foi identificar seqüências do genoma de RSNV que possibilitassem sua detecção em plantas de arroz através da técnica de transcrição reversa seguida da reação em cadeia da polimerase (RT-PCR). As seqüências do genoma foram identificadas a partir de clones de uma biblioteca de cDNAs obtidos de uma amostra do vírus parcialmente purificado. Os clones que hibridizaram com sondas sintetizadas a partir de RNA de plantas infectadas com RSNV foram seqüenciados e comparados às seqüências do GenBank. Um fragmento de 957 nt da extremidade 3’ da fita de um dos 4 RNAs genômicos de RSNV foi obtido. A análise da seqüência nucleotídeos desse fragmento não revelou qualquer similaridade com seqüências conhecidas, tampouco indicou uma possível função. Um par de oligonucleotídeos iniciadores foi desenhado a partir de um clone que potencialmente contém uma seqüência de RSNV. A especificidade e a sensibilidade da RT-PCR utilizando esse par de oligonucleotídeos iniciadores, bem como sua eficiência na detecção do vírus em diferentes partes da planta de arroz, foram avaliadas. Os resultados indicam que a RT-PCR é específica para RSNV e pode detectar o vírus em tecido oriundo das raízes, do colo e de folhas com distorção. Comparada ao diagnóstico da doença através da observação de sintomas e de estruturas do vetor, a RT-PCR é uma ferramenta confiável para a diagnose do enrolamento do arroz.

Diagnóstico das propriedades de consistência temporal em DMI`s: uma abordagem baseada na TDF RT-LOTOS

Orientador: Paulo Nazareno Maia Sampaio

Comparative validation using quantitative real-time PCR (qPCR) and conventional PCR of bovine semen centrifuged in continuous density gradient

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Characterization of bovine transcripts preferentially expressed in testis and with a putative role in spermatogenesis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

PEWS-RT, um sistema de tempo de execução para a linguagem PEWS

Web services are loosely coupled applications that use XML documents as a way of integrating distinct systems on the internet. Such documents are used by in standards such as SOAP, WSDL and UDDI which establish, respectively, integrated patterns for the representation of messages, description, and publication of services, thus facilitating the interoperability between heterogeneous systems. Often one single service does not meet the users needs, therefore new systems can be designed from the composition of two or more services. This which is the design goal behind the of the Service Oriented Architecture. Parallel to this scenario, we have the PEWS (Predicate Path-Expressions for Web Services) language, which speci es behavioural speci cations of composite web service interfaces.. The development of the PEWS language is divided into two parts: front-end and back-end. From a PEWS program, the front-end performs the lexical analysis, syntactic and semantic compositions and nally generate XML code. The function of the back-end is to execute the composition PEWS. This master's dissertation work aims to: (i) reformulate the proposed architecture for the runtime system of the language, (ii) Implement the back-end for PEWS by using .NET Framework tools to execute PEWS programs using the Windows Work ow Foundation

Assessment of cytokine values in serum by RT-PCR in HIV-1 infected individuals with and without highly active anti-retroviral therapy (HAART)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

The heminested RT-PCR for the study of rabies virus pathogenesis

The aim of the present trial was to evaluate the heminested RT-PCR for the study of rabies virus distribution in mice inoculated experimentally. Inoculation was by the intramuscular route in 150 mice, using the dog street rabies virus. Groups of five animals were killed at different times. Fragments of different organs were collected and the material was tested by Fluorescent Antibody Test (FAT) and heminested RT-PCR (hn RT-PCR). Positive results were obtained beginning on the 10th day after inoculation in the brain, spinal cord, salivary gland, limbs, lungs, liver, spleen, urinary bladder, tongue and right kidney. Hn RT-PCR was shown to be more efficient for the study of rabies virus distribution in different tissues and organs. (C) 2004 Elsevier B.V.. All rights reserved.

Comparison between RT-PCR and the mouse inoculation test for detection of rabies virus in samples kept for long periods under different conditions

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)