Fractionation of Zn, Cd and Pb in a Tropical Soil After Nine-Year Sewage Sludge Applications

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

The role of sugar cane straw on soil reaction

Conduziram-se dois experimentos em laboratório avaliar o efeito da palha da cana- de-açúcar na acidez do solo. A palha da cana foi adicionada nas doses de 0, 20, 40, e 76 g kg-1 na superfície de um latossolo roxo distrófico acondicionado em colunas de PVC. O solo foi incubado a capacidade de campo durante 0, 7, 14, 45, e 90 dias. Após cada incubação, o solo das colunas foram subdividido e amostrado nas seguintes frações 0-5, 5-10, 10-15, 15-20, e 20-25 cm. Com o aumento da dose da palha da cana verificou-se aumento do pH CaCl2 do solo e decréscimo do alumínio trocável até a camada de 15 cm de solo da coluna de PVC. A contribuição de compostos orgânicos para a destoxificação do Al aumentou com o acréscimo das doses da palha da cana. O crescimento da raiz das plantas trigo usadas como planta indicadora aumentou com o acréscimo das doses da palha de cana. O máximo de crescimento da raiz foi até a camada de 15 cm de solo depois de oito dias para a maior dose de palha da cana-de-açúcar.

Estrutura genética de Chromis multilineata (Guichenot, 1853) (Perciformes Pomacentridae) na costa NE do Brasil e ilhas oceânicas: evidências de um passado evolutivo instável.

The fauna of Brazilian reef fishes comprises approximately 320 species distributed along the coast of the mainland and islands ocean. Little is known about the levels of connectivity between their populations, but has been given the interest in the relations between the offshore and the islands of the Brazil, in a biogeographical perspective. The oceanic islands Brazilian hosting a considerable number of endemic species, which are locally abundant, and divide a substantial portion of its reef fish fauna with the Western Atlantic. Among the richest families of reef fish in species are Pomacentridae. This study analyzed through analysis of sequences of the mitochondrial DNA control region (D-loop), the standards-breeding population of C. Multilineata in different areas of the NE coast of Brazil, involving both oceanic islands (Fernando de Noronha Archipelago and of St. Peter and St. Paul) and continental shelf (RN and BA). To this aim, partial sequences were used in the region HVR1 of mtDNA (312pb). The population structure and parameters for the estimates of genetic variability, molecular variance (AMOVA), estimation of the index for fixing (FST) and number of migrants were determined. The phylogenetic relationships between the populations were estimated using neighbor-joining (NJ) method. A group of Bayesian analysis was used to verify population structure, according to haplotype frequency of each individual. The genetic variability of populations was extremely high. The populations sampled show moderate genetic structure, with a higher degree of genetic divergence being observed for the sample of the Archipelago of St. Peter and St. Paul. At smaller geographical scale, the sample of Rio Grande do Norte and the Archipelago of Fernando de Noronha do not have genetic differentiation. Three moderately differentiated population groups were identified: a population group (I), formed by the Rio Grande do Norte (I') and the archipelago of Fernando de Noronha (I''), and two other different groups formed by the island population of the archipelago of Saint Peter and St. Paul (II) and Bahia (III). The genetic patterns found suggest that the species has suffered a relatively recent radiation favoring the absence of shared haplotypes. C. multilineata seems to constitute a relatively homogenous population along the West Atlantic coast, with evidence of a moderate population genetic structure in relation to the Archipelago of St. Peter and St. Paul. These data supports the importance of the dispersal larvae by marine current and the interpopulation similarity this species.

Monoclinic-tetragonal phase transition in Pb(Zr1-xTix)O-3 studied by infrared spectroscopy

The discovery of a new monoclinic phase in the PbZr1-xTixO3 (PZT) system in the vicinity of the morphotropic phase boundary (MPB), previously considered as a region where the rhombohedral and tetragonal phases of PZT coexist, was recently reported. Investigations of this new phase were reported using different techniques such as high-resolution synchrotron x-ray powder diffraction and Raman spectroscopy. The main objective has been to define a new phase diagram of PZT. In this context, infrared spectroscopic studies were performed in the vicinity of the MPB and studies were initially centred on a PZT sample with x = 0.49 mol% Ti content. Results suggested that the monoclinic --> tetragonal phase transition occurs at 237 K, confirming the use of IR as a useful technique to investigate this phase transition.

4-amine-2-mercaptopyrimidine modified silica gel applied in Cd(II) and Pb(II) extraction from an aqueous medium

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Evidence for the monoclinic-tetragonal phase coexistence in Pb(Zr(0.53)Ti(0.47))O(3) thin films

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Determinação de Ba, Cd, Cr, Cu, Ni, Pb, Sn e Zn em Tainha (Mugil brasiliensis) nos estuários potiguares

Heavy metals can cause problems of human poisoning by ingestion of contaminated food, and the environment, a negative impact on the aquatic fauna and flora. And for the presence of these metals have been used for aquatic animals biomonitoramento environment. This research was done in order to assess the environmental impact of industrial and domestic sewage dumped in estuaries potiguares, from measures of heavy metals in mullet. The methods used for these determinations are those in the literature for analysis of food and water. Collections were 20 samples of mullet in several municipality of the state of Rio Grande do Norte, from the estuaries potiguares. Were analyzed the content of humidity, ash and heavy metals. The data were subjected to two methods of exploratory analysis: analysis of the main components (PCA), which provided a multivariate interpretation, showing that the samples are grouped according to similarities in the levels of metals and analysis of hierarchical groupings (HCA), producing similar results. These tests have proved useful for the treatment of the data producing information that would hardly viewed directly in the matrix of data. The analysis of the results shows the high levels of metallic species in samples Mugil brasiliensis collected in Estuaries /Potengi, Piranhas/Açu, Guaraíra / Papeba / Arês and Curimataú

Evolução geodinâmica e condicionamento estrutural dos terrenos Piancó-Alto Brígida e Alto Pajeú, domínio da zona transversal, NE do Brasil

This thesis aims to advance in the geological knowledge of the region comprising the Piancó-Alto Brígida (TPAB) and Alto pajeú (TAP) terranes, in the Transversal Zone Domain (Borborema Province, NE Brazil), with the main objective of understanding the geodynamic evolution and the structural framework of these units. To reach this objective, and besides field work and interpretation of traditional aerial photographs, other tools were employed like of remote sensing products (Landsat 7 ETM+, aeroradiometrics, aeromagnetics and topographical images), lithogeochemical (whole rock) analyses and geochronological dating (U-Pb in zircon), besides integration with literature data. In the area, several precambrian geological units outcrop, represented in the TAP by the paleoproterozoic Serra Talhada and Afogados da Ingazeira complexes, Riacho Gravatá Complex (metavolcano-sedimentary sequence of Stenian-Tonian age) and Cariris Velhos orthogneisses (of Tonian age). The TPAB comprises the Santana do Garrote (lower unit) and Serra do Olho d'Água (upper unit) formations of the Cachoeirinha Group (Neoproterozoic III), besides the Piancó orthogneisses and Bom Jesus paragneisses; the latter correspond to an older (basement ?) block and a possible high grade equivalent of the Cachoeirinha Group (or Seridó Group ?), respectively. Several Brasiliano-age plutons occur in both terranes.The aeromagnetic data show the continuity, at depth, of the main shear zones mapped in the region. The Patos, Pernambuco, Boqueirão dos Cochos, Serra do Caboclo, Afogados da Ingazeira/Jabitacá and Congo-Cruzeiro do Nordeste shear zones reach depths greater than to 6-16 km. The aeromagnetic signature of other shear zones, like the Juru one, suggests that these structures correspond to shallower crustal features. The satellite images (Landsat 7 ETM+) and aerogamaspectrometric images discriminate different geological units, contributing to the mapping of the structural framework of the region. The Serra do Caboclo Shear Zone was characterized as the boundary/suture between the TPAB and TAP. This structure is an outstanding, pervasive feature that separates contrasting geological units, such as the Neoproterozoic III Cachoeirinha Group in the TPAB and the Riacho Gravatá Complex and the Cariris Velhos metaplutonics, of Stenian-Tonian age, in the TAP. Occupying different blocks, these units are not found in authoctonous relations, like unconformities and intrusive contacts. Concerning the Cariris Velhos (ca. 1,0 Ga old) event is recorded by radiometric ages of the Riacho Gravatá Complex metavolcanics and intrusive augen and orthogneisses, all of them displaying geochemical affinities of arc or collisional settings. A structural signature of this event was not recorded in the region, possibly due to its low grade/low strain style, obliterated by the overprinting of younger, higher grade/high strain Brasiliano-age fabrics.The first tectonic event (D1) observed in the Cariris Velhos lithotypes presents contractional kinematics with transport to the NW. Neoproterozoic III geochronologic dates, obtained in late-D1 granitoids, imply a Brasiliano age (ca. 610-600 Ma) for this deformation event. The second tectonic event (D2) characterized in the region corresponds to the Brasiliano transcurrent kinematics of the outstanding shear zones and associated granitoid plutons. The geochronological (U-Pb in zircon) data obtained during this thesis also confirms the occurrence of the Cariris Velhos magmatic suite in the TAP, as well as the Neoproterozoic III age to the Cachoeirinha Group in the TPAB. The TAP (Riacho Gravatá Complex, augen and orthogneisses) is interpreted as a continental arc possibly accreted to a microcontinent during the Cariris Velhos (Stenian-Tonian) event. Later on, this terrane collided with the TPAB at the beginning of the Brasiliano orogeny (D1 contractional deformation), and both domins were reworked by the transcurrent shear deformation of the D2 event

Evolução tectono-estrutural do Campo de Xaréu (Sub-bacia de Mundaú, Bacia do Ceará - NE do Brasil: abordagem multiescala e pluriferramental

The Xaréu Oil Field, located in the center-southern portion of the Mundaú Sub-Basin (eastern portion of the Ceará Basin), is characterized by a main Iramework of NW-trending and NE-dipping faults. The faults in the Xaréu Oil Field, among which the Xaréu Fautt stands out, are arranged according to an extensional-listriclan, rooted on a detachment surface corresponding to the Mundaú Fault, the border fautt of Mundaú Sub-Basin. During the tectonic-structural evolution of the Xaréu Oil Field and the Mundaú Sub-Basin, the Mundaú Fault played a crucial role on the control of the geometry of both compartments. The main carbonatic unit in the Xaréu Oil Field, named the Trairí Member(Paracuru Formation of Late Aptian to Early Albian age), contains the largest oil volume in the field, concentrated in structurally-controlled accumulations. The Trairí Member is composed by a variety of carbonatic rocks (massive, bedded or laminated calcilutites, ostracodites, calcarenites and carbonatic rudites, all of them presenting variable degrees of dolomitization). The carbonatic rocks are interbedded into thick packages of black shales and marls, besides local beds of siliciclastic conglomerates, sandstones, siltnes and argillites. From the spatial association and the genetic relationships between the carbonatic and siliciclastic units, it is possible to group them in three lithofacies associations (Marginal Plain, Ramp and Lacustrine Interior) that, together, were developed in a lacustrine system associated to a marginal sabkha. Structural studies based on drill coresthat sample the Trairí Member in the Xaréu Oil Field allowed to characterize two generations of meso- to microscale structures: the D1 group presents a typical hydroplastic character, being characterized by intra/interstratal to oblique-bedding shear zones. The hydroplastic character related to these structures allowed to infer their development at an early-lithilication stage of the Trairí Member, leading to infer an Early Cretaceous age to them. The second group of structures identified in the drill cores, nominated D2 and ascribed to a Neogene age, presents a strictly brttle character, being typilied by normal faults and slickenfibers of re-crystallized clayminerals, ali olthem displaying variable orientations. Although the present faults in the Xaréu Oil Field (and, consequently, in the Mundaú Sub-Basin) were classically relerred as struetures of essentially normal displacement, the kinematics analysis of the meso-to microscaie D1 struetures in the drill cores led to deline oblique displacements (normal with a clockwise strike-slip component) to these faults, indicating a main tectonic transport to ENE. These oblique movements would be responsible for the installation of a transtensive context in the Mundaú Sub-Basin, as part of the transcurrent to translormant opening of the Atlantic Equatorial Margin. The balancing of four struetural cross-sections ofthe Xaréu Oil Field indicates that the Mundaú Fault was responsible for more than 50% of the total stretching (ß factor) registered during the Early Aptian. At the initial stages of the "rifting", during Early Aptianuntil the Holocene, the Mundaú Sub-Basin (and consequently the Xaréu Oil Fleld) accumulated a total stretching between 1.21 and 1.23; in other words, the crust in this segment of the Atlantic Equatorial Margin was subjeeted to an elongation of about 20%. From estimates of oblique displacements related to the faults, it ws possible to construct diagrams that allow the determination of stretching factors related to these displacements. Using these diagrams and assuming the sense 01 dominant teetonictransport towards ENE, it was possible to calculate the real stretching lactors related to the oblique movement 0 of the faults in the Mundaú Sub-Basin. which reached actual values between 1.28 and 1.42. ln addnion to the tectonic-structural studies in the Xaréu Oil Field, the interpretation of remote sensing products, coupled wnh characterization of terrain analogues in seleeted areas along the northern Ceará State (continental margins of the Ceará and Potiguar basins), provided addnional data and constraints about the teetonic-structural evolution of the oil lield. The work at the analogue sites was particularly effective in the recognition and mapping, in semidetail scale, several generations of struetures originated under a brittle regime. Ali the obtained information (from the Xaréu Oil Field, the remote sensor data and the terrain analogues) were jointly interpreted, culminating with the proposnion of an evolutionary model lor this segment of the Atlantic Equatorial Margin; this model that can be applied to the whole Margin, as well. This segmentof the Atlantic Equatorial Margin was delormedin an early E-W (when considered lhe present-day position of the South American Plate) transcurrent to transform regime with dextral kinematics, started Irom, at least, the Early Aptian, which left its record in several outcrops along the continental margin of the Ceará State and specilically in the Xaréu off Field. The continuous operation of the regime, through the Albian and later periods, led to the definitive separation between the South American and African plates, with the formation of oceanic lithosphere between the two continental blocks, due to the emplacement off spreading centers. This process involved the subsequent transition of the transcurrent to a translorm dextral regime, creating lhe Equatorial Atlantic Oceano With the separation between the South American and African plates already completed and the increasing separation between lhe continental masses, other tecton ic mechanisms began to act during the Cenozoic (even though the Cretaceous tectonic regime lasted until the Neogene), like an E-W compressive stress líeld (related to the spreading olthe oceanic floor along lhe M id-Atlantic Ridge and to the compression of the Andean Chain) effective Irom the Late Cretaceous, and a state of general extension olthe horizontal surface (due to the thermal uplift ofthe central portion of Borborema Province), effective during the Neogene. The overlap of these mechanisms during the Cenozoic led to the imprint of a complex tectonic framework, which apparently influenced the migration and entrapment 01 hydrocarbon in the Ceará Basin

Geologia, Geocronologia, Geoquímica e Petrogênese das Rochas Ígneas Cretácicas da Província Magmática do Cabo e suas Relações com as Unidades Sedimentares da Bacia de Pernambuco (NE do Brasil)

The area studied forms a thin NNE-directed belt situated south of Recife town (Pernambuco state), northeastern Brazil. Geologically, it comprises the Pernambuco Basin (PB), which is limited by the Pernambuco Lineament to the north, the Maragogi high to the south and the Pernambuco Alagoas massif to the west, all of them with Precambrian age. This thesis reports the results obtained for the Cabo Magmatic Province (CMP), aiming the characterization of the geology, stratigraphy, geochronology, geochemistry and petrogenesis of the Cretaceous igneous rocks presented in the PB. The PB is composed of the Cabo Formation (rift phase) at the base (polymictic conglomerates, sandstones, shales), an intermediate unit, the Estiva Formation (marbles and argillites), and, at the top, the Algodoais Formation (monomictic conglomerates, sandstones, shales). The CMP is represented by trachytes, rhyolites, pyroclastics (ignimbrites), basalts / trachy-andesites, monzonites and alkali-feldspar granite, which occur as dykes, flows, sills, laccoliths and plugs. Field observations and well descriptions show that the majority of the magmatic rocks have intrusive contacts with the Cabo Formation, although some occurrences are also suggestive of synchronism between volcanism and siliciclastic sedimentation. 40Ar/39Ar and zircon fission tracks for the magmatic rocks indicate an average age of 102 r 1 Ma for the CMP. This age represents an expressive event in the province and is detected in all igneous dated materials. It is considered as a minimum age (Albian) for the magmatic episode and the peak of the rift phase in the PB. The 40Ar/39Ar dates are about 10-14 Ma younger than published palynologic ages for this basin. Geochemically, the CMP may be divided in two major groups; i) a transitional to alkaline suite, constituted by basalts to trachy-andesites (types with fine-grained textures and phenocrysts of sanidine and plagioclase), trachytes (porphyrytic texture, with phenocrysts of sanidine and plagioclase) and monzonites; ii) a alkaline suite, highly fractionated, acidic volcano-plutonic association, formed by four subtypes (pyroclastic flows ignimbrites, fine-to medium-grained rhyolites, a high level granite, and later rhyolites). These four types are distinguished essentially by field aspects and petrographic and textural features. Compatible versus incompatible trace element concentrations and geochemical modeling based on both major and trace elements suggest the evolution through low pressure fractional crystallization for trachytes and other acidic rocks, whereas basalts / trachy-andesites and monzonites evolved by partial melting from a mantle source. Sr and Nd isotopes reveal two distinct sources for the rocks of the CMP. Concerning the acidic ones, the high initial Sr ratios (ISr = 0.7064-1.2295) and the negative HNd (-0.43 to -3.67) indicate a crustal source with mesoproterozoic model ages (TDM from 0.92 to 1.04 Ga). On the other hand, the basic to intermediate rocks have low ISr (0.7031-0.7042) and positive HNd (+1.28 to +1.98), which requires the depleted mantle as the most probable source; their model ages are in the range 0.61-0.66 Ga. However, the light rare earth enrichment of these rocks and partial melting modeling point to an incompatible-enriched lherzolitic mantle with very low quantity of garnet (1-3%). This apparent difference between geochemical and Nd isotopes may be resolved by assuming that the metasomatizing agent did not obliterate the original isotopic characteristics of the magmas. A 2 to 5% partial melting of this mantle at approximately 14 kbar and 1269oC account very well the basalts and trachy-andesites studied. By using these pressure and temperatures estimates for the generation of the basaltic to trachy-andesitic magma, it is determined a lithospheric stretching (E) of 2.5. This E value is an appropriated estimate for the sub-crustal stretching (astenospheric or the base of the lithosphere?) region under the Pernambuco Basin, the crustal stretching probably being lower. The integration of all data obtained in this thesis permits to interpret the magmatic evolution of the PB as follows; 1st) the partial melting of a garnet-bearing lherzolite generates incompatible-enriched basaltic, trachy-andesitic and monzonitic magmas; 2nd) the underplating of these basaltic magmas at the base of the continental crust triggers the partial melting of this crust, and thus originating the acidic magmas; 3rd) concomitantly with the previous stage, trachytic magmas were produced by fractionation from a monzonitic to trachy-andesitic liquid; 4th) the emplacement of the several magmas in superficial (e.g. flows) or sub-superficial (e.g. dykes, sills, domes, laccoliths) depths was almost synchronically, at about 102 r 1 Ma, and usually crosscutting the sedimentary rocks of the Cabo Formation. The presence of garnet in the lherzolitic mantle does not agree with pressures of about 14 kbar for the generation of the basaltic magma, as calculated based on chemical parameters. This can be resolved by admitting the astenospheric uplifting under the rift, which would place deep and hot material (mantle plume?) at sub-crustal depths. The generation of the magmas and their subsequent emplacement would be coupled with the crustal rifting of the PB, the border (NNE-SSW directed) and transfer (NW-SE directed) faults serving as conduits for the magma emplacement. Based on the E parameter and the integration of 40Ar/39Ar and palynologic data it is interpreted a maximum duration of 10-14 Ma for the rift phase (Cabo Formation clastic sedimentation and basic to acidic magmatism) of the PB

Estimativa de espessura crustal na Província Borborema (NE/Brasil) através de função do recpetor

Crustal thickness and VP/VS estimates are essential to the studies of subsurface geological structures and also to the understanding of the regional tectonic evolution of a given area. In this dissertation, we use the Langston´s (1979) Receiver Function Method using teleseismic events reaching the seismographic station with angles close to the vertical. In this method, the information of the geologic structures close to the station is isolated so that effects related to the instrument response and source mechanics are not present. The resulting time series obtained after the deconvolution between horizontal components contains the larger amplitude referring to the P arrival, followed by smaller arrival caused by the reverberation and conversion of the P-wave at the base of the crust. We also used the HK-Stacking after Zhu & Kanamori (2000) to obtain crustal thickness and Vp/VS estimates. This method works stacking receiver functions so that the best estimates of crustal thickness and Vp/VS are found when the direct P, the Ps wave and the first multiple are coherently stacked. We used five broadband seismographic stations distributed over the Borborema Province, NE Brazil. Crustal thickness and Vp/VS estimates are consistent with the crust-mantle interface obtained using gravity data. We also identified crutal thickening in the NW portion of the province, close to Sobral/CE. Towards the center-north portion of the province, there is an evident crustal thinning which coincides with a geological feature consisting of an alignment of sedimentary basins known as the Cariris-Potiguar trend. Towards the NE portion of the province, in Solânea/PB and Agrestina/PE regions, occurs a crustal thickening and a systematic increase in the VP/VS values which suggest the presence of mafic rocks in the lower crust also consistent with the hypothesis of underplating in the region

Petrologia do magmatismo tardi-brasiliano no Maciço São José de Campestre(RN/PB), com ênfase no Plúton Alcalino Caxexa

The area studied is located on the north-easternmost portion of the Borborema Province, on the so-called São José de Campestre Massif, States of RN and PB, Northeast Brazil. Field relations and petrographic, geochemical and isotope data permitted the separation of five suites of plutonic rocks: alkali-feldspar granite (Caxexa Pluton), which constitutes the main subject of this dissertation, amphibole-biotite granite (Cabeçudo Pluton), biotite microgranite, gabbronorite to monzonite (Basic to Intermediate Suite) and aluminous granitoid. The Caxexa Pluton is laterally associated to the Remígio Pocinhos Shear Zone, with its emplacement along the mylonitic contact between the gneissic basement and the micashists. This pluton corresponds to a syntectonic intrusion elongated in the N-S direction, with about 50 km2 of outcropping surface. It is composed exclusively of alkali-feldspar granites, having clinopyroxene (aegirine-augite and hedenbergite), andradite-rich garnet, sphene and magnetite. It is classified geochemically as high silica rocks (>70 % wt), metaluminous to slightly peraluminous (normative corindon < 1%), with high total alkalis (>10% wt), Sr, iron number (#Fe=90-98) and agpaitic index (0.86-1.00), and positive europium anomaly. The Cabeçudo Pluton is composed of porphyritic rocks, commonly containing basic to intermediate magmatic enclaves often with mingling and mixing textures. Petrographically, it presents k-feldspar and plagioclase phenocrysts as the essential minerals, besides the accessories amphibole, biotite, sphene and magnetite. It is metaluminous and shows characteristics transitional between the calc-alkaline and alkaline series (or monzonitic subalkaline). Its REE content is greater than those ones of the Caxexa Pluton and biotite microgranite, and all spectra have negative europium anomalies. The biotite microgranites occur mainly on the central and eastern portion of the mapped area, as dykes and sheets with decimetric thickness, hosted principally in orthogneisses and micashists. Their field relationships as regards the Caxexa and Cabeçudo plutons suggested that they are late-tectonic intrusions. They are typically biotite granites, having also sphene, amphibole, allanite, opaques and zircon in the accessory assemblage. Geochemically they can be distinguished from the porphyritic types because the biotite microgranites are more evolved, peraluminous, and have more fractionated REE spectra. The Basic to Intermediate rocks form a volumetrically expressive elliptical, kilometric scale body on the Southeast, as well as sheets in micashists. They are classified as gabbronorites to monzonites, with the two pyroxenes and biotite, besides subordinated amounts of amphibole, sphene, ilmenite and allanite. These rocks do not show a well-defined geochemical trend, however they may possibly represent a monzonitic (shoshonitic) series. Their REE spectra have negative europium anomalies and REE contents greater than the other suites. The aluminous granitoids are volumetrically restricted, and have been observed in close association with migmatised micashists bordering the gabbronorite pluton. They are composed of almandine-rich garnet, andalusite, biotite and muscovite, and are akin to the peraluminous suites. Rb-Sr (whole rock) and Sm-Nd (whole-rock and mineral) isotopes furnished a minimum estimate of the crystallization (578±14 Ma) and the final resetting age of the Rb-Sr system (536±4 Ma) in the Caxexa Pluton. The aluminous granitoid has a Sm-Nd garnet age similar to that one of the Caxexa Pluton, that is 574±67 Ma. The strong interaction of shear bands and pegmatite dykes favoured the opening of the Rb-Sr system for the Caxexa Pluton and biotite microgranite. The amphibole-plagioclase geothermometer and the Al-in amphibole geobarometer indicate minimum conditions of 560°C and 7 kbar for the Cabeçudo Pluton, 730°C and 6 kbar for the microgranite and 743°C and 5 kbar for the basic to intermediate suite. The Zr saturation geothermometer reveals temperatures of respectively 855°C, 812°C and 957°C for those suites, whereas the Caxexa Pluton shows temperatures of around 757°C. The Caxexa, Cabeçudo and microgranites suites crystallized under high fO2 (presence of magnetite). On the other hand, the occurrence of ilmenite suggests less oxidant conditions in the basic to intermediate suite. Field relations demonstrate the intrusive character of the granitoids into a tectonically relatively stable continental crust. This is corroborated by petrographic and geochemical data, which suggest a late- or post-collisional tectonic context. It follows that the generation and emplacement of those granitoid suites is related to the latest events of the Brasiliano orogeny. Finally, the relationships between eNd (600 Ma), TDM (Nd) and initial Sr isotope ratio (ISr) do not permit to define the precise sources of the granitoids. Nevertheless, trace element modelling and isotopic comparisons suggest the participation of the metasomatised mantle in the generation of these suites, probably modified by different degrees of crustal contamination. In this way, a metasomatised mantle would not be a particular characteristic of the Neoproterozoic lithosphere, but a remarkable feature of this portion of the Borborema Province since Archaean and Paleoproterozoic times.

Petrologia dos granitóides brasilianos associados à zona de cisalhamento Remígio-Pocinhos(PB)

The Brasiliano Cycle in the Seridó Belt (NE Brazil) is regarded mostly as a crustal reworking event, characterized by transcurrent or transpressional shear zones which operated under high temperature and low pressure conditions. In the eastern domain of this belt- the so-called São José de Campestre Massif (SJCM), a transtensional deformation regime is evidenced by extensional components or structures associated to the strikeslip shear zones. The emplacement of the Neoproterozoic Brasiliano granitoids is strongly controled by these discontinuities. Located in the southern border of the SJCM, the Remígio-Pocinhos shear zone (RPSZ) displays, in its northern half, top to the SW extensional movement which progressively grade, towards its southern half, to a dextral strike-slip kinematics, defining a negative semi-flower structure. This shear zone is overprinted upon allocthonous metasediments of the Seridó Group and an older gneiss-migmatite complex, both of which containing metamorphic parageneses from high amphibolite to granulite facies (the latter restricted to the strike-slip zone), defining the peak conditions of deformation. Several granitoid plutons are found along this structure, emplaced coeval with the shearing event. Individually, such bodies do not exceed 30 km2 in outcropping area and are essentially parallel to the trend of the shear zone. Petrographic, textural and geochemical data allow to recognize five different granitoid suites along the RPSZ: porphyritic granites (Serra da Boa Vista and Jandaíra), alkaline granites (Serra do Algodão and Serra do Boqueirão) and medium to coarse-grained granites (Olivedos) as major plutons, while microgranite and aluminous leucogranite sheets occur as minor intrusions. The porphyritic granites are surrounded by metasediments and present sigmoidal or en cornue shapes parallel to the trend of the RPSZ, corroborating the dextral kinematics. Basic to intermediate igneous enclaves are commonly associated to these bodies, frequently displaying mingling textures with the host granitoids. Compositionally these plutons are made up by titanite-biotite monzogranites bearing amphibole and magnetite; they are peraluminous and show affinities to the monzonitic, subalkaline series. Peraluminous, ilmenite-bearing biotite monzogranites and titanite-biotite monzogranites correspond, respectivally, to the Olivedos pluton and the microgranites. The Olivedos body is hosted by metasediments, while the microgranites intrude the gneiss-migmatite complex. Being highly evolved rocks, samples from these granites plot in the crustal melt fields in discrimination diagrams. Nevertheless, their subtle alignment also looks consistent with a monzonitic, subalkaline affinity. These chemical parameters make them closer to the I-type granites. Alkaline, clearly syntectonic granites are also recognized along the RPSZ. The Serra do Algodão and Serra do Boqueirão bodies display elongated shapes parallel to the mylonite belt which runs between the northern, extensional domain and the southern strike-slip zone. The Serra do Algodão pluton shows a characteristic isoclinal fold shape structure. Compositionally they encompass aegirine-augite alkali-feldspar granites and quartz-bearing alkaline syenite bearing garnet (andradite) and magnetite plus ilmenite as opaque phases. These rocks vary from meta to peraluminous, being correlated to the A-type granites. Aluminous leucogranites bearing biotite + muscovite ± sillimanite ± garnet (S-type granites) are frequent but not volumetrically important along the RPSZ. These sheet-like bodies may be folded or boudinaged, representing partial melts extracted from the metasediments during the shear zone development. Whole-rock Rb-Sr isotope studies point to a minimum 554��10 Ma age for the crystalization of the porphyritic granites. The alkaline granites and the Olivedos granite produced ca. 530 Ma isochrons which look too young; such values probably represent the closure of the Rb-Sr radiometric clock after crystallization and deformation of the plutons, at least 575 Ma ago (Souza et al. 1998). The porphyritic and the alkaline granites crystallized under high oxygen fugacity conditions, as shown by the presence of both magnetite and hematite in these rocks. The presence of ilmenite in the Olivedos pluton suggests less oxidizing conditions. Amphibole and amphibole-plagioclase thermobarometers point to minimum conditions, around 750°C and 6 Kbars, for the crystallization of the porphyritic granites. The zirconium geothermometer indicates higher temperatures, in the order of 800°C, for the porphyritic granites, and 780°C for the Olivedos pluton. Such values agree with the thermobarometric data optained for the country rocks (5,7 Kbar and 765°C; Souza et al. 1998). The geochemical and isotope data set point to a lower crustal source for the porphyritic and the alkaline granites. Granulite facies quartz diorite to tonalite gneisses, belonging or akin to the gneiss-migmatite complex, probably dominate in the source regions. In the case of the alkaline rocks, subordinate contributions of mantle material may be present either as a mixing magma or as a previously added component to the source region. Tonalite to granodiorite gneisses, with some metasedimentary contribution, may be envisaged for the Olivedos granite. The diversity of granitoid rocks along the RPSZ is explained by its lithospheric dimension, allowing magma extraction at different levels, from the middle to lower crust down to the mantle. The presence of basic to intermediate enclaves, associated to the porphyritic granites, confirm the participation of mantle components in the magma extraction system along the RPSZ. This mega-structure is part of the network of Brasiliano-age shear zones, activated by continental collision and terrane welding processes at the end of the Neoproterozoic

Análise de terrenos na porção setentrional da Província Borborema, NE do Brasil: integração de dados geológicos e gravimétricos

It is presently assumed that the Borborema Province resulted from a complex collisional process associated with the convergent movement of plates, possibly involving amalgamation and accretion of microplates. This process was consolidated at the end of the Brasiliano event. It is investigated the possible limits for the tectonostratigraphic terranes in the northern portion of the province based on an integrated study of geological and gravity data. The study area comprises the portion of the Borborema Province located north of the Patos Lineament, limited by longitudes 33º00 W and 43º29 44"W and latitudes 1º36 S and 8º00 S. A revision of the regional geology allowed to identify areas presenting contrasting geological attributes, possibly representing different terranes whose limits are always shear zones of Brasiliano-age. The Sobral-Pedro II shear zone is the only one undoubtedly presenting geological attributes of sutures zones. The other shear zones are very likely associated with a geodinymic context of accretion, involving oblique collisions (docking), transcurrent and/or transforming sutures, and deep intracrustal shear zones. The gravity data contributed as a tool to identify strong lateral contrasts of density inside the upper crust possibly associated with crustal blocks tectonically juxtaposed. The dominant long wavelength anomaly in the Bouguer anomaly map is an expressive gradient, grossly parallel to the continental margin, caused by density variation across the crust-mantle interface in the transition from the continental crust to the oceanic crust originated by the separation between South America and Africa. Medium to small wavelength anomalies are due to intracrustal heterogeneities such as different Precambrian crustal blocks, Brasiliano-age granites and Mesozoic sedimentary basins. A regional-residual separation of the Bouguer anomaly map was performed in order to enhance in the residual map the effect due to intracrustal heterogeneities. The methodology used for this separation was a robust polinomial fitting. The inversion of residual gravity field resulted in a density contrast map (Δρ), in an equivalent layer that provided more accurated anomalies contours and consolidated the model which the sources of residual anomalies are located in the upper part of the present crust. Based on the coincidence of gravity lineaments in the residual map and Brasiliano shear zones, and using additional geological information, the following shear zones are proposed as limits between terranes: Patos shear zone, Sobral-Pedro II shear zone, Picuí-João Câmara shear zone, Remígio-Pocinhos shear zone, Senador Pompeu shear zone, Tauá shear zone, and Portalegre shear zone. Based on the geological/geophysical information it is attributed a higher level of confidence to the first three proposed limits(Patos, Sobral Pedro II, and Picuí-João Câmara shear zones). From west to east, these shear zones individualize the following terranes: Northwest of Ceará terrane, Central Ceará terrane, Tauá terrane, Orós-Jaguaribe terrane, Seridó terrane, and São José de Campestre terrane. In our study, the Rio Piranhas and Patos terranes are questioned because their previously proposed limits do not present good geological and gravimetric evidences. On the other hand, the previously proposed Cearense terrane is now subdivided into Central Ceará and Tauá terranes. Two residual gravity profiles located in the Seridó belt were interpreted using 2 ½ D direct gravity modeling. The main result of the modeling process is that all anomalies, with the exception of one, can be explained by outcroppring bodies, therefore restricted to the upper part of the present crust