957 resultados para NreABC, nitrate regulation, reporter gene
Resumo:
Sterol-regulated transcription of the gene for rat farnesyl diphosphate (FPP) synthase (geranyl-diphosphate:isopentenyl-diphosphate geranyltranstransferase, EC 2.5.1.10) is dependent in part on the binding of the ubiquitous transcription factor NF-Y to a 6-bp element within the proximal promoter. Current studies identify a second element in this promoter that is also required for sterol-regulated transcription in vivo. Mutation of three nucleotides (CAC) within this element blocks the 8-fold induction of FPP synthase promoter-reporter genes that normally occurs when the transfected cells are incubated in medium deprived of sterols. Gel mobility-shift assays demonstrate that the transcriptionally active 68-kDa fragment of the sterol regulatory element (SRE-1)-binding protein assays (SREBP-1) binds to an oligonucleotide containing the wild-type sequence but not to an oligonucleotide in which the CAC has been mutated. DNase 1 protection pattern (footprint) analysis indicates that SREBP-1 binds to nucleotides that include the CAC. Both the in vivo and in vitro assays are affected by mutagenesis of nucleotides adjacent to the CAC. Coexpression of SREBP with a wild-type FPP synthase promoter-reporter gene in CV-1 cells results in very high levels of reporter activity that is sterol-independent. In contrast, the reporter activity remained low when the promoter contained a mutation in the CAC trinucleotide. We conclude that sterol-regulated transcription of FPP synthase is controlled in part by the interaction of SREBP with a binding site that we have termed SRE-3. Identification of this element may prove useful in the identification of other genes that are both regulated by SREBP and involved in lipid biosynthesis.
Resumo:
Promoter and silencer elements of the immediate 5' flanking region of the gene coding for human factor VII were identified and characterized. The major transcription start site, designated as +1, was determined by RACE (rapid amplification of cDNA ends) analysis of human liver cDNA and was found to be located 50 bp upstream from the translation start site. Two minor transcription start sites were found at bp +32 bp and +37. Progressive deletions of the 5' flanking region were fused to the chloramphenicol acetyltransferase reporter gene and transient expression in HepG2 and HeLa cells was measured. Two promoter elements that were essential for hepatocyte-specific transcription were identified. The first site, FVIIP1, located at bp -19 to +1, functioned independently of orientation or position and contributed about one-third of the promoter activity of the factor VII gene. Electrophoretic mobility-shift, competition, and anti-hepatocyte nuclear factor 4 (HNF4) antibody supershift experiments demonstrated that this site contained an HNF-4 binding element homologous to the promoters in the genes coding for factor IX and factor X. The second site, FVIIP2, located at bp -50 to -26, also functioned independent of orientation or position and contributed about two thirds of the promoter activity in the gene for factor VII. Functional assays with mutant sequences demonstrated that a 10-bp G + C-rich core sequence which shares 90% sequence identity with the prothrombin gene enhancer was essential for the function of the second site. Mobility-shift and competition assays suggested that this site also binds hepatic-specific factors as well as the transcription factor Sp1. Two silencer elements located upstream of the promoter region spanning bp -130 to -103 (FVIIS1 site) and bp -202 to -130 (FVIIS2) were also identified by reporter gene assays.
Resumo:
mRNAs for acetylcholine receptor genes are highly concentrated in the endplate region of adult skeletal muscle largely as a result of a transcription restricted to the subneural nuclei. To identify the regulatory elements involved, we employed a DNA injection of a plasmid containing a fragment of the acetylcholine receptor delta-subunit gene promoter (positions -839 to +45) linked to the reporter gene lacZ with a nuclear localization signal. Injection of the wild-type construct into mouse leg muscles yielded preferential expression of the reporter gene in the synaptic region. Analysis of various mutant promoters resulted in the identification of a DNA element (positions -60 to -49), referred to as the N box, that plays a critical role in subneural expression. Disruption of this 12-bp element in the context of a mouse delta-subunit promoter from positions -839 to +45 gives widespread expression of the reporter gene throughout the entire muscle fiber, indicating that this element is a silencer that represses delta-subunit gene transcription in extrajunctional areas. On the other hand, this element inserted upstream of a heterologous basal promoter preferentially enhances expression in the endplate region. This element therefore regulates the restricted expression of the delta-subunit gene both as an enhancer at the endplate level and as a silencer in extrajunctional areas. Furthermore, gel-shift experiments with mouse muscle extracts reveal an activity that specifically binds the 6-bp sequence TTCCGG of this element, suggesting that a transcription factor(s) controls the expression of the delta-subunit gene via this element.
Resumo:
Although prolactin and interleukin 2 (IL-2) can elicit distinct physiological responses, we have found that their signal pathways share a common signal transducer and activator of transcription, STAT5. STAT5 was originally identified as a mammary gland factor induced by prolactin in lactating breast cells. Here we demonstrate that STAT5 is activated after IL-2 stimulation of two responsive lymphocyte cell lines, Nb2 and YT. Activation of STAT5 is measured both by IL-2-induced tyrosine phosphorylation and by IL-2-induced DNA binding. The STAT5 DNA recognition site is the same as the interferon gamma-activated site (GAS) in the interferon regulatory factor 1 gene. We demonstrate that the GAS element is necessary and sufficient for transcriptional induction by both IL-2 and prolactin in T lymphocytes. These results indicate that the role of STAT5 in the regulation of gene expression is not restricted to mammary cells or to prolactin, but is an integral part of the signal pathway of a critical immunomodulatory cytokine, IL-2.
Resumo:
Viral vectors are the most efficient tools for gene delivery, and the search for tissue-specific infecting viruses is important for the development of in vivo gene therapy strategies. The baculovirus Autographa californica nuclear polyhedrosis virus is widely used as a vector for expression of foreign genes in insect cells, and its host specificity is supposed to be restricted to arthropods. Here we demonstrate that recombinant A. californica nuclear polyhedrosis virus is efficiently taken up by human hepatocytes via an endosomal pathway. High-level reporter gene expression from heterologous promoters was observed in human and rabbit hepatocytes in vitro. Mouse hepatocytes and some other epithelial cell types are targeted at a considerably lower rate. The efficiency of gene transfer by baculovirus considerably exceeds that obtained by calcium phosphate or lipid transfection. These properties of baculovirus suggest a use for it as a vector for liver-directed gene transfer but highlight a potential risk in handling certain recombinant baculoviruses.
Resumo:
The mechanisms regulating expression of mouse mammary tumor virus (MMTV)-encoded superantigens from the viral sag gene are largely unknown, due to problems with detection and quantification of these low-abundance proteins. To study the expression and regulation of the MMTV sag gene, we have developed a sensitive and quantitative reporter gene assay based on a recombinant superantigen-human placental alkaline phosphatase fusion protein. High sag-reporter expression in Ba/F3, an early B-lymphoid cell line, depends on enhancers in either of the viral long terminal repeats (LTRs) and is largely independent of promoters in the 5' LTR. The same enhancer region is also required for general expression of MMTV genes from the 5' LTR. The enhancer was mapped to a 548-bp fragment of the MMTV LTR lying within sag and shown to be sufficient to stimulate expression from a heterologous simian virus 40 promoter. No enhancer activity of the MMTV LTR was observed in XC sarcoma cells, which are permissive for MMTV. Our results demonstrate a major role for this enhancer in MMTV gene expression in early B-lymphoid cells.
Resumo:
A sequence of epithelial cell proliferation, allocation to four principal lineages, migration-associated differentiation, and cell loss occurs along the crypt-villus axis of the mouse intestine. The sequence is completed in a few days and is recapitulated throughout the life-span of the animal. We have used an intestine-specific fatty acid binding protein gene, Fabpi, as a model for studying regulation of gene expression in this unique developmental system. Promoter mapping studies in transgenic mice identified a 20-bp cis-acting element (5'-AGGTGGAAGCCATCACACTT-3') that binds small intestinal nuclear proteins and participates in the control of Fabpi's cephalocaudal, differentiation-dependent, and cell lineage-specific patterns of expression. Immunocytochemical studies using confocal and electron microscopy indicate that it does so by acting as a suppressor of gene expression in the distal small intestine/colon, as a suppressor of gene activation in proliferating and nonproliferating cells located in the crypts of Lieberkühn, and as a suppressor of expression in the growth factor and defensin-producing Paneth cell lineage. The 20-bp domain has no obvious sequence similarities to known transcription factor binding sites. The three functions modulated by this compact element represent the types of functions required to establish and maintain the intestine's remarkably complex spatial patterns of gene expression. The transgenes described in this report also appear to be useful in characterizing the crypt's stem cell hierarchy.
Resumo:
We demonstrate that the cauliflower mosaic virus (CaMV) gene VI product can transactivate the expression of a reporter gene in bakers' yeast, Saccharomyces cerevisiae. The gene VI coding sequence was placed under the control of the galactose-inducible promoter GAL1, which is presented in the yeast shuttle vector pYES2, to create plasmid JS169. We also created a chloramphenicol acetyltransferase (CAT) reporter plasmid, JS161, by inserting the CAT reporter gene in-frame into CaMV gene II and subsequently cloning the entire CaMV genome into the yeast vector pRS314. When JS161 was transformed into yeast and subsequently assayed for CAT activity, only a very low level of CAT activity was detected in cellular extracts. To investigate whether the CaMV gene VI product would mediate an increase in CAT activity, we cotransformed yeast with JS169 and JS161. Upon induction with galactose, we found that CAT activity in yeast transformed with JS161 and JS169 was about 19 times higher than the level in the transformants that contained only JS161. CAT activity was dependent on the presence of the gene VI protein, because essentially no CAT activity was detected in yeast cells grown in the presence of glucose, which represses expression from the GAL1 promoter. RNase protection assays showed that the gene VI product had no effect on transcription from the 35S RNA promoter, demonstrating that regulation was occurring at the translation level. This yeast system will prove useful for understanding how the gene VI product of CaMV mediates the translation of genes present on a eukaryotic polycistronic mRNA.
Resumo:
Alu repeats are interspersed repetitive DNA elements specific to primates that are present in 500,000 to 1 million copies. We show here that an Alu sequence encodes functional binding sites for retinoic acid receptors, which are members of the nuclear receptor family of transcription factors. The consensus sequences for the evolutionarily recent Alu subclasses contain three hexamer half sites, related to the consensus AGGTCA, arranged as direct repeats with a spacing of 2 bp, which is consistent with the binding specificities of retinoic acid receptors. An analysis was made of the DNA binding and transactivation potential of these sites from an Alu sequence that has been previously implicated in the regulation of the keratin K18 gene. These Alu double half sites are shown to bind bacterially synthesized retinoic acid receptors as assayed by electrophoretic mobility shift assays. These sites are further shown to function as a retinoic acid response element in transiently transfected CV-1 cells, increasing transcription of a reporter gene by a factor of approximately 35-fold. This transactivation requires cotransfection with vectors expressing retinoic acid receptors, as well as the presence of all-trans-retinoic acid, which is consistent with the known function of retinoic acid receptors as ligand-inducible transcription factors. The random insertion of potentially thousands of Alu repeats containing retinoic acid response elements throughout the primate genome is likely to have altered the expression of numerous genes, thereby contributing to evolutionary potential.
Resumo:
Several polycations possessing substantial buffering capacity below physiological pH, such as lipopolyamines and polyamidoamine polymers, are efficient transfection agents per se--i.e., without the addition of cell targeting or membrane-disruption agents. This observation led us to test the cationic polymer polyethylenimine (PEI) for its gene-delivery potential. Indeed, every third atom of PEI is a protonable amino nitrogen atom, which makes the polymeric network an effective "proton sponge" at virtually any pH. Luciferase reporter gene transfer with this polycation into a variety of cell lines and primary cells gave results comparable to, or even better than, lipopolyamines. Cytotoxicity was low and seen only at concentrations well above those required for optimal transfection. Delivery of oligonucleotides into embryonic neurons was followed by using a fluorescent probe. Virtually all neurons showed nuclear labeling, with no toxic effects. The optimal PEI cation/anion balance for in vitro transfection is only slightly on the cationic side, which is advantageous for in vivo delivery. Indeed, intracerebral luciferase gene transfer into newborn mice gave results comparable (for a given amount of DNA) to the in vitro transfection of primary rat brain endothelial cells or chicken embryonic neurons. Together, these properties make PEI a promising vector for gene therapy and an outstanding core for the design of more sophisticated devices. Our hypothesis is that its efficiency relies on extensive lysosome buffering that protects DNA from nuclease degradation, and consequent lysosomal swelling and rupture that provide an escape mechanism for the PEI/DNA particles.
Resumo:
The cystic fibrosis transmembrane conductance regulator (CFTR) functions as a Cl- channel that becomes activated after phosphorylation by cAMP-dependent protein kinase (PKA). We demonstrate that PKA also plays a crucial role in maintaining basal expression of the CFTR gene in the human colon carcinoma cell line T84. Inhibition of PKA activity by expression of a dominant-negative regulatory subunit or treatment with the PKA-selective inhibitor N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide (H-89) caused a complete suppression of CFTR gene expression without affecting other constitutively active genes. Basal expression of a 2.2-kb region of the CFTR promoter linked to a luciferase reporter gene (CFTR-luc) exhibited the same dependence on PKA. The ability of cAMP to induce CFTR over basal levels is cell-type specific. In T84 cells, both the endogenous CFTR gene and CFTR-luc exhibited only a modest inducibility (approximately 2-fold), whereas in the human choriocarcinoma cell line JEG-3, CFTR-luc could be induced at least 4-fold. A variant cAMP-response element is present at position -48 to -41 in the CFTR promoter, and mutation of this sequence blocks basal expression. We conclude that cAMP, acting through PKA, is an essential regulator of basal CFTR gene expression and may mediate an induction of CFTR in responsive cell types.
Resumo:
We describe a complete gene family encoding phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) in one particular plant species. In parsley (Petroselinum crispum), the PAL gene family comprises two closely related members, PAL1 and PAL2, whose TATA-proximal promoter and coding regions are almost identical, and two additional members, PAL3 and PAL4, with less similarity to one another and to the PAL1 and PAL2 genes. Using gene-specific probes derived from the 5' untranslated regions of PAL1/2, PAL3, and PAL4, we determined the respective mRNA levels in parsley leaves and cell cultures treated with UV light or fungal elicitor and in wounded leaves and roots. For comparison, the functionally closely related cinnamate 4-hydroxylase (C4H) and 4-coumarate:CoA ligase (4CL) mRNAs were measured in parallel. The results indicate various degrees of differential responsiveness of PAL4 relative to the other PAL gene family members, in contrast to a high degree of coordination in the overall expression of the PAL, C4H, and 4CL genes. The only significant sequence similarities shared by all four PAL gene promoters are a TATA-proximal set of three putative cis-acting elements (boxes P, A, and L). None of these elements alone, or the promoter region containing all of them together, conferred elicitor or light responsiveness on a reporter gene in transient expression assays. The elements appear to be necessary but not sufficient for elicitor- or light-mediated PAL gene activation, similar to the situation previously reported for 4CL.
Resumo:
The abundance of delta-crystallin in the chicken eye lens provides an advantageous marker for tissue-specific gene expression during cellular differentiation. The lens-specific expression of the delta 1-crystallin gene is governed by an enhancer in the third intron, which binds a positive (delta EF2) and negative (delta EF1) factor in its core region. Here we show by DNase I footprinting, electrophoretic mobility-shift assays, and cotransfection experiments with the delta 1-promoter/enhancer fused to the chloramphenicol acetyltransferase reporter gene that the delta 1-crystallin enhancer has two adjacent functional Pax-6 binding sites. We also demonstrate by DNase I footprinting that the delta EF1 site can bind the transcription factor USF, raising the possibility that USF may cooperate with Pax-6 in activation of the chicken delta 1- and alpha A-crystallin genes. These data, coupled with our recent demonstration that Pax-6 activates the alpha A-crystallin gene, suggest that Pax-6 may have been used extensively throughout evolution to recruit and express crystallin genes in the lens.
Resumo:
Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.