Disordered matter studied by x-ray Raman scattering

Spectroscopy can provide valuable information on the structure of disordered matter beyond that which is available through e.g. x-ray and neutron diffraction. X-ray Raman scattering is a non-resonant element-sensitive process which allows bulk-sensitive measurements of core-excited spectra from light-element samples. In this thesis, x-ray Raman scattering is used to study the local structure of hydrogen-bonded liquids and solids, including liquid water, a series of linear and branched alcohols, and high-pressure ice phases. Connecting the spectral features to the local atomic-scale structure involves theoretical references, and in the case of hydrogen-bonded systems the interpretation of the spectra is currently actively debated. The systematic studies of the intra- and intermolecular effects in alcohols, non-hydrogen-bonded neighbors in high-pressure ices, and the effect of temperature in liquid water are used to demonstrate different aspects of the local structure that can influence the near-edge spectra. Additionally, the determination of the extended x-ray absorption fine structure is addressed in a momentum-transfer dependent study. This work demonstrates the potential of x-ray Raman scattering for unique studies of the local structure of a variety of disordered light-element systems.

Variations in the cyclotron resonant scattering features during 2011 outburst of 4U 0115+63

We study the variations in the Cyclotron Resonant Scattering Feature (CRSF) during 2011 outburst of the high mass X-ray binary 4U 0115+63 using observations performed with Suzaku, RXTE, Swift and INTEGRAL satellites. The wide-band spectral data with low-energy coverage allowed us to characterize the broad-band continuum and detect the CRSFs. We find that the broad-band continuum is adequately described by a combination of a low temperature (kT similar to 0.8 keV) blackbody and a power law with high energy cutoff (E-cut similar to 5.4 keV) without the need for a broad Gaussian at similar to 10 keV as used in some earlier studies. Though winds from the companion can affect the emission from the neutron star at low energies (<3 keV), the blackbody component shows a significant presence in our continuum model. We report evidence for the possible presence of two independent sets of CRSFs with fundamentals at similar to 11 and similar to 15 keV. These two sets of CRSFs could arise from spatially distinct emitting regions. We also find evidence for variations in the line equivalent widths, with the 11 keV CRSF weakening and the 15 keV line strengthening with decreasing luminosity. Finally, we propose that the reason for the earlier observed anticorrelation of line energy with luminosity could be due to modelling of these two independent line sets (similar to 11 and similar to 15 keV) as a single CRSF.

Pulsed neutron experiments in graphite

Detailed pulsed neutron measurements have been performed in graphite assemblies ranging in size from 30.48 cm x 38.10 cm x 38.10 cm to 91.44 cm x 66.67 cm x 66.67 cm. Results of the measurement have been compared to a modeled theoretical computation.

In the first set of experiments, we measured the effective decay constant of the neutron population in ten graphite stacks as a function of time after the source burst. We found the decay to be non-exponential in the six smallest assemblies, while in three larger assemblies the decay was exponential over a significant portion of the total measuring interval. The decay in the largest stack was exponential over the entire ten millisecond measuring interval. The non-exponential decay mode occurred when the effective decay constant exceeded 1600 sec^( -1).

In a second set of experiments, we measured the spatial dependence of the neutron population in four graphite stacks as a function of time after the source pulse. By doing an harmonic analysis of the spatial shape of the neutron distribution, we were able to compute the effective decay constants of the first two spatial modes. In addition, we were able to compute the time dependent effective wave number of neutron distribution in the stacks.

Finally, we used a Laplace transform technique and a simple modeled scattering kernel to solve a diffusion equation for the time and energy dependence of the neutron distribution in the graphite stacks. Comparison of these theoretical results with the results of the first set of experiments indicated that more exact theoretical analysis would be required to adequately describe the experiments.

The implications of our experimental results for the theory of pulsed neutron experiments in polycrystalline media are discussed in the last chapter.

Measurement of the neutron (^3He) spin structure function at low Q^2 : a connection between the Bjorken and Drell-Hearn-Gerasimov sum rules

The spin dependent cross sections, σT_1/2 and σT_3/2 , and asymmetries, A_∥ and A_⊥ for ³He have been measured at the Jefferson Lab's Hall A facility. The inclusive scattering process ³He(e,e)X was performed for initial beam energies ranging from 0.86 to 5.1 GeV, at a scattering angle of 15.5°. Data includes measurements from the quasielastic peak, resonance region, and the deep inelastic regime. An approximation for the extended Gerasimov-Drell-Hearn integral is presented at a 4-momentum transfer Q² of 0.2-1.0 GeV².

Also presented are results on the performance of the polarized ³He target. Polarization of ³He was achieved by the process of spin-exchange collisions with optically pumped rubidium vapor. The ³He polarization was monitored using the NMR technique of adiabatic fast passage (AFP). The average target polarization was approximately 35% and was determined to have a systematic uncertainty of roughly ±4% relative.

Space-charge-limited current in fast neutron irradiated silicon

DC and transient measurements of space-charge-limited currents through alloyed and symmetrical n^+ν n^+ structures made of nominally 75 kΩcm ν-type silicon are studied before and after the introduction of defects by 14 MeV neutron radiation. In the transient measurements, the current response to a large turn-on voltage step is analyzed. Right after the voltage step is applied, the current transient reaches a value which we shall call "initial current" value. At longer times, the transient current decays from the initial current value if traps are present.

Before the irradiation, the initial current density-voltage characteristics J(V) agree quantitatively with the theory of trap-free space-charge-limited current in solids. We obtain for the electron mobility a temperature dependence which indicates that scattering due to impurities is weak. This is expected for the high purity silicon used. The drift velocity-field relationships for electrons at room temperature and 77°K, derived from the initial current density-voltage characteristics, are shown to fit the relationships obtained with other methods by other workers. The transient current response for t > 0 remains practically constant at the initial value, thus indicating negligible trapping.

Measurement of the initial (trap-free) current density-voltage characteristics after the irradiation indicates that the drift velocity-field relationship of electrons in silicon is affected by the radiation only at low temperature in the low field range. The effect is not sufficiently pronounced to be readily analyzed and no formal description of it is offered. In the transient response after irradiation for t > 0, the current decays from its initial value, thus revealing the presence of traps. To study these traps, in addition to transient measurements, the DC current characteristics were measured and shown to follow the theory of trap-dominated space-charge-limited current in solids. This theory was applied to a model consisting of two discrete levels in the forbidden band gap. Calculations and experiments agreed and the capture cross-sections of the trapping levels were obtained. This is the first experimental case known to us through which the flow of space-charge-limited current is so simply representable.

These results demonstrate the sensitivity of space-charge-limited current flow as a tool to detect traps and changes in the drift velocity-field relationship of carriers caused by radiation. They also establish that devices based on the mode of space-charge-limited current flow will be affected considerably by any type of radiation capable of introducing traps. This point has generally been overlooked so far, but is obviously quite significant.

Time-dependent monoenergetic neutron transport in two adjacent semi-infinite media

An exact solution to the monoenergetic Boltzmann equation is obtained for the case of a plane isotropic burst of neutrons introduced at the interface separating two adjacent, dissimilar, semi-infinite media. The method of solution used is to remove the time dependence by a Laplace transformation, solve the transformed equation by the normal mode expansion method, and then invert to recover the time dependence.

The general result is expressed as a sum of definite, multiple integrals, one of which contains the uncollided wave of neutrons originating at the source plane. It is possible to obtain a simplified form for the solution at the interface, and certain numerical calculations are made there.

The interface flux in two adjacent moderators is calculated and plotted as a function of time for several moderator materials. For each case it is found that the flux decay curve has an asymptotic slope given accurately by diffusion theory. Furthermore, the interface current is observed to change directions when the scattering and absorption cross sections of the two moderator materials are related in a certain manner. More specifically, the reflection process in two adjacent moderators appears to depend initially on the scattering properties and for long times on the absorption properties of the media.

This analysis contains both the single infinite and semi-infinite medium problems as special cases. The results in these two special cases provide a check on the accuracy of the general solution since they agree with solutions of these problems obtained by separate analyses.

Neutron irradiation effect in two-dimensional electron gas of AlGaN/GaN heterostructures

AlGaN/GaN heterostructures have been irradiated by neutrons with different influences and characterized by means of temperature-dependent Hall measurements and Micro-Raman scattering techniques. It is found that the carrier mobility of two-dimensional electron gas (2DEG) is very sensitive to neutrons. At a low influence of 6.13 x 10(15) cm(-2), the carrier mobility drops sharply, while the sheet carrier density remains the same as that of an unirradiated sample. Moreover, even for a fluence of up to 3.66 x 10(16) cm(-2), the sheet carrier density shows only a slight drop. We attribute the degradation of the figure-of-merit (product of n(s) x mu) of 2DEG to the defects induced by neutron irradiation. Raman measurements show that neutron irradiation does not yield obvious change to the strain state of AlGaN/GaN heterostructures, which proves that degradation of sheet carrier density has no relation to strain relaxation in the present study. The increase of the product of n(s) x mu of 2DEG during rapid thermal annealing processes at relatively high temperature has been attributed to the activation of Ge-Ga transmuted from Ga and the recovery of displaced defects.

Neutron spectroscopic factors of Ar-34 and Ar-46 from (p,d) transfer reactions

Single-neutron-transfer measurements using (p,d) reactions have been performed at 33 MeV per nucleon with proton-rich Ar-34 and neutron-rich Ar-46 beams in inverse kinematics. The extracted spectroscopic factors are compared to the large-basis shell-model calculations. Relatively weak quenching of the spectroscopic factors is observed between Ar-34 and Ar-46. The experimental results suggest that neutron correlations have a weak dependence on the asymmetry of the nucleus over this isotopic region. The present results are consistent with the systematics established from extensive studies of spectroscopic factors and dispersive optical-model analyses of Ca40-49 isotopes. They are, however, inconsistent with the trends obtained in knockout-reaction measurements.

Effects of elastic and inelastic NN scattering cross sections on pi(-)/pi(+) ratios in heavy-ion collisions at intermediate energies

Based on the isospin-dependent Boltzmann-Uehling-Uhlenbeck transport model and the scaling model according to nucleon effective mass, effects of elastic and inelastic NN scattering cross sections on pi(-)/pi(+) in the neutron-rich reaction of Ca-48 + Ca-48 at a beam energy of 400 MeV/nucleon are studied. It is found that cross-section effects of both NN elastic and inelastic scatterings affect Delta(1232), pi(-) and pi(+) production, as well as the value of pi(-)/pi(+).

Beam-target double-spin asymmetry A{LT} in charged pion production from deep inelastic scattering on a transversely polarized {3}He target at 1.4

We report the first measurement of the double-spin asymmetry A{LT} for charged pion electroproduction in semi-inclusive deep-inelastic electron scattering on a transversely polarized {3}He target. The kinematics focused on the valence quark region, 0.16neutron A{LT} asymmetries were extracted from the measured {3}He asymmetries and proton over {3}He cross section ratios using the effective polarization approximation. These new data probe the transverse momentum dependent parton distribution function g{1T}{q} and therefore provide access to quark spin-orbit correlations. Our results indicate a positive azimuthal asymmetry for π{-} production on {3}He and the neutron, while our π{+} asymmetries are consistent with zero.

Pairing with polarization effects in low-density neutron matter

We study the properties of the 1S0 pairing gap in low-density neutron matter. Different corrections to the lowest-order scattering length approximation are explored, resulting in a strong suppression with respect to the BCS result.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Influence of the halo upon angular distributions for elastic scattering and breakup

The angular distributions for elastic scattering and breakup of halo nuclei are analysed using a near-side/far-side decomposition within the framework of the dynamical eikonal approximation. This analysis is performed for (11)Be impinging on Pb at 69 MeV/nucleon. These distributions exhibit very similar features. In particular they are both near-side dominated, as expected from Coulomb-dominated reactions. The general shape of these distributions is sensitive mostly to the projectile-target interactions, but is also affected by the extension of the halo. This suggests the elastic scattering not to be affected by a loss of flux towards the breakup channel. (C) 2010 Elsevier B.V. All rights reserved.

Canonical quantum potential scattering theory

A new formulation of potential scattering in quantum mechanics is developed using a close structural analogy between partial waves and the classical dynamics of many non-interacting fields. Using a canonical formalism we find nonlinear first-order differential equations for the low-energy scattering parameters such as scattering length and effective range. They significantly simplify typical calculations, as we illustrate for atom-atom and neutron-nucleus scattering systems. A generalization to charged particle scattering is also possible.