Electrostatic modelling and measurement of airborne particles concentration

Granular air-borne particles generally carry very small amounts of electric charge as a consequence of charging by the triboelectric effect. The presence of such particles induces charge of opposite polarity on a stationary conducting electrode. The amount of charge carried by the particles and the trajectories of the particles have significant random components and the signals produced are of very low level. The signal processing is further complicated by the random variation in the concentration of particles, i.e. the solid/gas ratio. This paper compares the results obtained from the electrostatic modelling of such sensors with those obtained from experiments.

Solid phase velocity measurements utilising electrostatic sensors and cross correlation signal processing

Gas-solids two phase systems are widely employed within process plant in the form of pneumatic conveyors, dust extraction systems and solid fuel injection systems. The measurement of solids phase velocity therefore has wide potential application in flow monitoring and, in conjunction with density measurement instrumentation, solids mass flow rate measurement. Historically, a number of authors have detailed possible measurement techniques, and some have published limited test results. It is, however, apparent that none of these technologies have found wide application in industry. Solids phase velocity measurements were undertaken using real time cross correlation of signals from two electrostatic sensors spaced axially along a pipeline conveying pulverised coal (PF). Details of the measurement equipment, the pilot scale test rig and the test results are presented.

Recent applications of Chemical Imaging to pharmaceutical process monitoring and quality control

Chemical Imaging (CI) is an emerging platform technology that integrates conventional imaging and spectroscopy to attain both spatial and spectral information from an object. Vibrational spectroscopic methods, such as Near Infrared (NIR) and Raman spectroscopy, combined with imaging are particularly useful for analysis of biological/pharmaceutical forms. The rapid, non-destructive and non-invasive features of CI mark its potential suitability as a process analytical tool for the pharmaceutical industry, for both process monitoring and quality control in the many stages of drug production. This paper provides an overview of CI principles, instrumentation and analysis. Recent applications of Raman and NIR-CI to pharmaceutical quality and process control are presented; challenges facing Cl implementation and likely future developments in the technology are also discussed. (C) 2007 Elsevier B.V. All rights reserved.

Reducing Drifts in the Inertial Measurements of Wrist and Elbow Positions

In this paper, we present an inertial-sensor-based monitoring system for measuring the movement of human upper limbs. Two wearable inertial sensors are placed near the wrist and elbow joints, respectively. The measurement drift in segment orientation is dramatically reduced after a Kalman filter is applied to estimate inclinations using accelerations and turning rates from gyroscopes. Using premeasured lengths of the upper and lower arms, we compute the position of the wrist and elbow joints via a proposed kinematic model. Experimental results demonstrate that this new motion capture system, in comparison to an optical motion tracker, possesses an RMS position error of less than 0.009 m, with a drift of less than 0.005 ms-1 in five daily activities. In addition, the RMS angle error is less than 3??. This indicates that the proposed approach has performed well in terms of accuracy and reliability.

Portfolio of Compositions investigating ensemble improvisation, distributed and real-time scoring, and multi-nodal input and output

This output is a collection of compositions which explore issues of ensemble improvisation, ensemble management and orchestration, real-time and distributed scoring, multi-nodal inputs and outputs, and animated and graphic notation. Compositions include: Activities I; tutti, duet, trio, solo, quartet; Lewitt Notations I; Webwork I; and Sometimes I feel the space between people (voices) in terms of tempos. These compositions are presented in computer animated scores which are synchronized through the network and subject to real-time modification and control. They can be performed by ensembles distributed over large physical spaces connected by the network. The scores for these compositions include software which displays the animations to the performers, software to structure and disseminate score events, and triggering software that allows the control of a performance to be distributed. Scores can also include live electronics which are coordinated with graphic events.

Characterization and modelling of software defined radio front-ends

O presente trabalho tem por objectivo estudar a caracterização e modelação de arquitecturas de rádio frequência para aplicações em rádios definidos por software e rádios cognitivos. O constante aparecimento no mercado de novos padrões e tecnologias para comunicações sem fios têm levantado algumas limitações à implementação de transceptores rádio de banda larga. Para além disso, o uso de sistemas reconfiguráveis e adaptáveis baseados no conceito de rádio definido por software e rádio cognitivo assegurará a evolução para a próxima geração de comunicações sem fios. A ideia base desta tese passa por resolver alguns problemas em aberto e propor avanços relevantes, tirando para isso partido das capacidades providenciadas pelos processadores digitais de sinal de forma a melhorar o desempenho global dos sistemas propostos. Inicialmente, serão abordadas várias estratégias para a implementação e projecto de transceptores rádio, concentrando-se sempre na aplicabilidade específica a sistemas de rádio definido por software e rádio cognitivo. Serão também discutidas soluções actuais de instrumentação capaz de caracterizar um dispositivo que opere simultaneamente nos domínios analógico e digital, bem como, os próximos passos nesta área de caracterização e modelação. Além disso, iremos apresentar novos formatos de modelos comportamentais construídos especificamente para a descrição e caracterização não-linear de receptores de amostragem passa-banda, bem como, para sistemas nãolineares que utilizem sinais multi-portadora. Será apresentada uma nova arquitectura suportada na avaliação estatística dos sinais rádio que permite aumentar a gama dinâmica do receptor em situações de multi-portadora. Da mesma forma, será apresentada uma técnica de maximização da largura de banda de recepção baseada na utilização do receptor de amostragem passa-banda no formato complexo. Finalmente, importa referir que todas as arquitecturas propostas serão acompanhadas por uma introdução teórica e simulações, sempre que possível, sendo após isto validadas experimentalmente por protótipos laboratoriais.

Anytime information processing based on fuzzy and neural network models

In modern measurement and control systems, the available time and resources are often not only limited, but could change during the operation of the system. In these cases, the so-called anytime algorithms could be used advantageously. While diflerent soft computing methods are wide-spreadly used in system modeling, their usability in these cases are limited.

An extensible complex fast Fourier transform processor chip for real-time spectrum analysis and measurement

This paper describes in detail the design of a CMOS custom fast Fourier transform (FFT) processor for computing a 256-point complex FFT. The FFT is well-suited for real-time spectrum analysis in instrumentation and measurement applications. The FFT butterfly processor reported here consists of one parallel-parallel multiplier and two adders. It is capable of computing one butterfly computation every 100 ns thus it can compute a 256-point complex FFT in 102.4 μs excluding data input and output processes.

An integrated 256-point complex FFT processor for real-time spectrum analysis and measurement

This paper describes in detail the design of a custom CMOS Fast Fourier Transform (FFT) processor for computing 256-point complex FFT. The FFT is well suited for real-time spectrum analysis in instrumentation and measurement applications. The FFT butterfly processor consists of one parallel-parallel multiplier and two adders. It is capable of computing one butterfly computation every 100 ns thus it can compute 256-complex point FFT in 25.6 μs excluding data input and output processes.

Narrow-band variable center frequency single-loop and multistage sigma-delta modulators for bandpass signals

Oversampled narrow-band single-loop and multistage resonator-based bandpass sigma-delta (Σ-Δ) modulators that can accommodate different passband center to sampling frequency ratios are reported. These tunable bandpass configurations are designed by analytically determining and subsequently verifying through detailed empirical simulations the required compensation hardware to deliver enhanced noise-shaping. It is demonstrated that comparatively superior in-band signal-to-noise ratios and dynamic ranges are attributed to the inclusion of appropriate digital feedforward and feedback compensators within these structures.

Analyse de mon langage musical à travers trois œuvres

La version intégrale de ce mémoire est disponible uniquement pour consultation individuelle à la Bibliothèque de musique de l’Université́ de Montréal (www.bib.umontreal.ca/MU).

Historical and current machine intelligence

In this article, we provide an initial insight into the study of MI and what it means for a machine to be intelligent. We discuss how MI has progressed to date and consider future scenarios in a realistic and logical way as much as possible. To do this, we unravel one of the major stumbling blocks to the study of MI, which is the field that has become widely known as "artificial intelligence"

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Observed changes in top-of-the-atmosphere radiation and upper-ocean heating consistent within uncertainty

Global climate change results from a small yet persistent imbalance between the amount of sunlight absorbed by Earth and the thermal radiation emitted back to space. An apparent inconsistency has been diagnosed between interannual variations in the net radiation imbalance inferred from satellite measurements and upper-ocean heating rate from in situ measurements, and this inconsistency has been interpreted as ‘missing energy’ in the system. Here we present a revised analysis of net radiation at the top of the atmosphere from satellite data, and we estimate ocean heat content, based on three independent sources. We find that the difference between the heat balance at the top of the atmosphere and upper-ocean heat content change is not statistically significant when accounting for observational uncertainties in ocean measurements, given transitions in instrumentation and sampling. Furthermore, variability in Earth’s energy imbalance relating to El Niño-Southern Oscillation is found to be consistent within observational uncertainties among the satellite measurements, a reanalysis model simulation and one of the ocean heat content records. We combine satellite data with ocean measurements to depths of 1,800 m, and show that between January 2001 and December 2010, Earth has been steadily accumulating energy at a rate of 0.50±0.43 Wm−2 (uncertainties at the 90% confidence level). We conclude that energy storage is continuing to increase in the sub-surface ocean.

Solar wind control of magnetospheric energy content: substorm quenching and multiple onsets

In this paper we report coordinated multispacecraft and ground-based observations of a double substorm onset close to Scandinavia on November 17, 1996. The Wind and the Geotail spacecraft, which were located in the solar wind and the subsolar magnetosheath, respectively, recorded two periods of southward directed interplanetary magnetic field (IMF). These periods were separated by a short northward IMF excursion associated with a solar wind pressure pulse, which compressed the magnetosphere to such a degree that Geotail for a short period was located outside the bow shock. The first period of southward IMF initiated a substorm growth. phase, which was clearly detected by an array of ground-based instrumentation and by Interball in the northern tail lobe. A first substorm onset occurred in close relation to the solar wind pressure pulse impinging on the magnetopause and almost simultaneously with the northward turning of the IMF. However, this substorm did not fully develop. In clear association with the expansion of the magnetosphere at the end of the pressure pulse, the auroral expansion was stopped, and the northern sky cleared. We will present evidence that the change in the solar wind dynamic pressure actively quenched the energy available for any further substorm expansion. Directly after this period, the magnetometer network detected signatures of a renewed substorm growth phase, which was initiated by the second southward turning of the IMF and which finally lead to a second, and this time complete, substorm intensification. We have used our multipoint observations in order to understand the solar wind control of the substorm onset and substorm quenching. The relative timings between the observations on the various satellites and on the ground were used to infer a possible causal relationship between the solar wind pressure variations and consequent substorm development. Furthermore, using a relatively simple algorithm to model the tail lobe field and the total tail flux, we show that there indeed exists a close relationship between the relaxation of a solar wind pressure pulse, the reduction of the tail lobe field, and the quenching of the initial substorm.