Root Secretion of Defense-related Proteins Is Development-dependent and Correlated with Flowering Time

Proteins found in the root exudates are thought to play a role in the interactions between plants and soil organisms. To gain a better understanding of protein secretion by roots, we conducted a systematic proteomic analysis of the root exudates of Arabidopsis thaliana at different plant developmental stages. In total, we identified 111 proteins secreted by roots, the majority of which were exuded constitutively during all stages of development. However, defense-related proteins such as chitinases, glucanases, myrosinases, and others showed enhanced secretion during flowering. Defense-impaired mutants npr1-1 and NahG showed lower levels of secretion of defense proteins at flowering compared with the wild type. The flowering-defective mutants fca-1, stm-4, and co-1 showed almost undetectable levels of defense proteins in their root exudates at similar time points. In contrast, root secretions of defense-enhanced cpr5-2 mutants showed higher levels of defense proteins. The proteomics data were positively correlated with enzymatic activity assays for defense proteins and with in silico gene expression analysis of genes specifically expressed in roots of Arabidopsis. In conclusion, our results show a clear correlation between defense-related proteins secreted by roots and flowering time.

Evolutionary History of Arabidopsis thaliana Aminoacyl-tRNA Synthetase Dual-Targeted Proteins

Aminoacyl-transfer RNA (tRNA) synthetases (aaRS) are key players in translation and act early in protein synthesis by mediating the attachment of amino acids to their cognate tRNA molecules. In plants, protein synthesis may occur in three subcellular compartments (cytosol, mitochondria, and chloroplasts), which requires multiple versions of the protein to be correctly delivered to its proper destination. The organellar aaRS are nuclear encoded and equipped with targeting information at the N-terminal sequence, which enables them to be specifically translocated to their final location. Most of the aaRS families present organellar proteins that are dual targeted to mitochondria and chloroplasts. Here, we examine the dual targeting behavior of aaRS from an evolutionary perspective. Our results show that Arabidopsis thaliana aaRS sequences are a result of a horizontal gene transfer event from bacteria. However, there is no evident bias indicating one single ancestor (Cyanobacteria or Proteobacteria). The dual-targeted aaRS phylogenetic relationship was characterized into two different categories (paralogs and homologs) depending on the state recovered for both dual-targeted and cytosolic proteins. Taken together, our results suggest that the dual-targeted condition is a gain-of-function derived from gene duplication. Selection may have maintained the original function in at least one of the copies as the additional copies diverged.

Translational incorporation of L-3,4-dihydroxyphenylalanine into proteins

An Escherichia coli cell-free transcription/translation system was used to explore the high-level incorporation Of L-3,4-dihydroxyphenylalanine (DOPA) into proteins by replacing tyrosine with DOPA in the reaction mixtures. ESI-MS showed specific incorporation of DOPA in place of tyrosine. More than 90% DOPA incorporation at each tyrosine site was achieved, allowing the recording of clean N-15-HSQC NMR spectra. A redox-staining method specific for DOPA was shown to provide a sensitive and generally applicable method for assessing the cell-free production of proteins. Of four proteins produced in soluble form in the presence of tyrosine, two resulted in insoluble aggregates in the presence of high levels of DOPA. DOPA has been found in human proteins, often in association with various disease states that implicate protein aggregation and/or misfolding. Our results suggest that misfolded and aggregated proteins may result, in principle, from ribosome-mediated misincorporation of intracellular DOPA accumulated due to oxidative stress. High-yield cell-free protein expression systems are uniquely suited to obtain rapid information on solubility and aggregation of nascent polypeptide chains.

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Metabolic syndrome features small, apolipoprotein A-I-poor, triglyceride-rich HDL3 particles with defective anti-apoptotic activity

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Immunohistochemical analysis of p53, APE1, hMSH2 and ERCC1 proteins in actinic cheilitis and lip squamous cell carcinoma

Aims: This study has compared the tissue expression of the p53 tumour suppressor protein and DNA repair proteins APE1, hMSH2 and ERCC1 in normal, dysplastic and malignant lip epithelium. Methods and results: Morphological analysis and immunohistochemistry were performed on archived specimens of normal lip mucosa (n = 15), actinic cheilitis (AC) (n = 30), and lip squamous cell carcinoma (LSCC) (n = 27). AC samples were classified morphologically according to the severity of epithelial dysplasia and risk of malignant transformation. LSCC samples were morphologically staged according to WHO and invasive front grading (IFG) criteria. Differences between groups and morphological stages were determined by bivariate statistical analysis. Progressive increases in the percentage of epithelial cells expressing p53 and APE1 were associated with increases in morphological malignancy from normal lip mucosa to LSCC. There was also a significant reduction in epithelial cells expressing hMSH2 and ERCC1 proteins in the AC and LSCC groups. A higher percentage of malignant cells expressing APE1 was found in samples with an aggressive morphological IFG grade. Conclusions: Our data showed that epithelial cells from premalignant to malignant lip disease exhibited changes in the expression of p53, APE1, hMSH2 and ERCC1 proteins; these molecular change might contribute to lip carcinogenesis.

Identification of intracellular and extracellular domains mediating signal transduction in the inhibitory glycine receptor chloride channel

Fast synaptic neurotransmission is mediated by transmitter-activated conformational changes in ligand-gated ion channel receptors, culminating in opening of the integral ion channel pore. Human hereditary hyperekplexia, or startle disease, is caused by mutations in both the intracellular or extracellular loops flanking the pore-lining M2 domain of the glycine receptor alpha 1 subunit. These flanking domains are designated the M1-M2 loop and the M2-M3 loop respectively. We show that four startle disease mutations and six additional alanine substitution mutations distributed throughout both loops result in uncoupling of the ligand binding sites from the channel activation gate. We therefore conclude that the M1-M2 and M2-M3 loops act in parallel to activate the channel. Their locations strongly suggest that they act as hinges governing allosteric control of the M2 domain. As the members of the ligand-gated ion channel superfamily share a common structure, this signal transduction model may apply to all members of this superfamily.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Acute Pancreatitis Hypertonic Saline Increases Heat Shock Proteins 70 and 90 and Reduces Neutrophil Infiltration in Lung Injury

Objectives: Acute pancreatitis (AP) protease release induces lung parenchymal destruction via matrix metalloproteinases (MMPs), a neutrophil (polymorphonuclear leukocyte)-dependent process. Recent studies in hemorrhagic shock revealed that hypertonic saline (HTS) has an anti-inflammatory effect and can inhibit a variety of neutrophil functions. The aim of this study was to determine whether HTS and its actions in the pathway of neutrophil migration, MMPs, and heat shock proteins (HSPs) are effective in protecting the lung from injury associated with AP. Methods: We determined neutrophil infiltration and expressions of MMPs and HSPs in the lung tissue after AP induced by retrograde infusion of 2.5% of sodium taurocholate. Results: Animals submitted to AP that received HTS compared with those who received normal saline presented with increased HSP70 and HSP90 expressions and reduced myeloperoxidase levels and MMP-9 expression and activity. Conclusions: Our data raised the hypothesis that a sequence of HTS lung protection events increases HSP70 and HSP90, inhibiting infiltration of neutrophils and their protease actions in the lung.

The glycine receptor

The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. The GlyR comprises a pentameric complex that forms a chloride-selective transmembrane channel, which is predominantly expressed in the spinal cord and brain stem. We review the pharmacological and physiological properties of the GlyR and relate this information to more recent insights that have been obtained through the cloning and recombinant expression of the GlyR subunits. We also discuss insights into our understanding of GlyR structure and function that have been obtained by the genetic characterisation of various heritable disorders of glycinergic neurotransmission. (C) 1997 Elsevier Science Inc.

Development of a synthetic 7-ketocholesterol- rich emulsion resembling chylomicrons

Lipid emulsions that mimic natural lipoproteins help to understand the metabolism and the constitutional organization of circulating lipids. Chylomicrons synthesised by enterocyte cells usually contain oxysterols such as 7-ketocholesterol (7-KC). Here we describe the development of a 7-KC-containing emulsion as a model for oxisterol-rich chylomicron. Different amounts of 7-KC were used. Emulsion characteristics as effective diameter, lipid saturation with radiolabeled lipids was evaluated. In conclusion, the production of a synthetic 7-KC-rich emulsion resembling hylomicrons was feasible, being a model for in vivo metabolism studies.