894 resultados para Dielectric Barrier Discharge (DBD)


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tool center point calibration is a known problem in industrial robotics. The major focus of academic research is to enhance the accuracy and repeatability of next generation robots. However, operators of currently available robots are working within the limits of the robot´s repeatability and require calibration methods suitable for these basic applications. This study was conducted in association with Stresstech Oy, which provides solutions for manufacturing quality control. Their sensor, based on the Barkhausen noise effect, requires accurate positioning. The accuracy requirement admits a tool center point calibration problem if measurements are executed with an industrial robot. Multiple possibilities are available in the market for automatic tool center point calibration. Manufacturers provide customized calibrators to most robot types and tools. With the handmade sensors and multiple robot types that Stresstech uses, this would require great deal of labor. This thesis introduces a calibration method that is suitable for all robots which have two digital input ports free. It functions with the traditional method of using a light barrier to detect the tool in the robot coordinate system. However, this method utilizes two parallel light barriers to simultaneously measure and detect the center axis of the tool. Rotations about two axes are defined with the center axis. The last rotation about the Z-axis is calculated for tools that have different width of X- and Y-axes. The results indicate that this method is suitable for calibrating the geometric tool center point of a Barkhausen noise sensor. In the repeatability tests, a standard deviation inside robot repeatability was acquired. The Barkhausen noise signal was also evaluated after recalibration and the results indicate correct calibration. However, future studies should be conducted using a more accurate manipulator, since the method employs the robot itself as a measuring device.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There is a dense serotonergic projection from nucleus raphe pallidus and nucleus raphe obscurus to the trigeminal motor nucleus and serotonin exerts a strong facilitatory action on the trigeminal motoneurons. Some serotonergic neurons in these caudal raphe nuclei increase their discharge during feeding. The objective of the present study was to investigate the possibility that the activity of these serotonergic neurons is related to activity of masticatory muscles. Cats were implanted with microelectrodes and gross electrodes. Caudal raphe single neuron activity, electrocorticographic activity, and splenius, digastric and masseter electromyographic activities were recorded during active behaviors (feeding and grooming), during quiet waking and during sleep. Seven presumed serotonergic neurons were identified. These neurons showed a long duration action potential (>2.0 ms), and discharged slowly (2-7 Hz) and very regularly (interspike interval coefficient of variation <0.3) during quiet waking. The activity of these neurons decreased remarkably during fast wave sleep (78-100%). Six of these neurons showed tonic changes in their activity positively related to digastric and/or masseter muscle activity but not to splenius muscle activity during waking. These data are consistent with the hypothesis that serotonergic neurons in the caudal raphe nuclei play an important role in the control of jaw movements

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tavallisten hapetusmenetelmien sijasta kehittyneitä hapetusmenetelmiä (AOP) on kehitetty yhä enemmän, jotta hapetusprosessista tulisi kannattavampi, tehokkaampi, ympäristöystävällisempi ja sitä voitaisiin hyödyntää laajalti eri paikoissa. Uusi teknologia, joka käyttää otsonia ja hydroksyyliradikaalia sähköimpulssien kanssa, on yksi mahdollinen tehokkaampi vedenkäsittelymentelmä. Kyseistä menetelmää kutsutaa pulsed corona discharge (PCD) -menetelmäksi, joka käyttää prosessissa muodostuvia otsonia ja hydroksyyliradikaalia hapettavina tekijöinä. Tässä työssä tutkittiin nitraatin muodostumista vedessä, kun vettä käsiteltiin PCD-laitteessa ja, kun oksalaatti- ja formaatti-ioneja oli sekoittuneina veteen. Nitraatteja muodostuu PCD–laitteessa veteen, kun ilman typpi reagoi hapettimina toimivien otsonin ja hydroksyyliradikaalin kanssa. Aiemmissa tutkimuksissa nitraatin muodostumisen on todistettu parantuvan, kun karboksyylihapot muurahais- ja oksaalihappo ovat sekoittuneina veteen. Tässä tutkimuksessa tarkoituksena oli tutkia, miten formaatti- ja oksalaatti-ionien, joiden pitoisuudet olivat 0 ppm, 50 ppm ja 100 ppm, läsnäolo vedessä vaikuttaa nitraatin muodostumiseen. PCD-kokeista saadut näytteet analysoitiin ionikromatografilla. Kyseisessä tutkimuksessa nitraatin muodostuminen oli samansuuruista jokaisessa kokeessa hapetusajan kasvaessa samalla, kun otettujen näytteiden pH-arvot laskivat. Tuloksena voitiin pitää sitä, ettei formaatti- tai oksalaatti-ioneilla ollut vaikutusta nitraatti-ionien muodostumiseen.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Neuron-specific enolase (NSE) is a glycolytic enzyme present almost exclusively in neurons and neuroendocrine cells. NSE levels in cerebrospinal fluid (CSF) are assumed to be useful to estimate neuronal injury and clinical outcome of patients with serious clinical manifestations such as those observed in stroke, head injury, anoxic encephalopathy, encephalitis, brain metastasis, and status epilepticus. We compared levels of NSE in serum (sNSE) and in CSF (cNSE) among four groups: patients with meningitis (N = 11), patients with encephalic injuries associated with impairment of consciousness (ENC, N = 7), patients with neurocysticercosis (N = 25), and normal subjects (N = 8). Albumin was determined in serum and CSF samples, and the albumin quotient was used to estimate blood-brain barrier permeability. The Glasgow Coma Scale score was calculated at the time of lumbar puncture and the Glasgow Outcome Scale (GOS) score was calculated at the time of patient discharge or death. The ENC group had significantly higher cNSE (P = 0.01) and albumin quotient (P = 0.005), but not sNSE (P = 0.14), levels than the other groups (Kruskal-Wallis test). Patients with lower GOS scores had higher cNSE levels (P = 0.035) than patients with favorable outcomes. Our findings indicate that sNSE is not sensitive enough to detect neuronal damage, but cNSE seems to be reliable for assessing patients with considerable neurological insult and cases with adverse outcome. However, one should be cautious about estimating the severity of neurological status as well as outcome based exclusively on cNSE in a single patient.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this Master’s thesis focused on the oxidation of sodium thiosulfate using non thermal plasma technology as an advance oxidation process (AOP). By using this technology we can degrade certain toxic chemical compounds present in mining wastewaters as pollutants. Different concentrations of thiosulfate and pulse frequencies were used in the PCD experiments and the results in terms of various delivered energies (kWh/m3) and degradation kinetics were compared. Pulsed corona discharge is an energy efficient process compared to other oxidation processes using for the treatment of waste water pollutants. Due to its simplicity and low energy costs make it attractive in the field of waste water treatment processes. This technology of wastewater treatment has been tested mainly on pilot scale level and in future the attempts are to be focus on PCD investigations on larger process scale. In this research work of oxidation of thiosulfate using pulsed corona discharge, the main aim of this research was to study degradation of a studied toxic and not environmental friendly chemical compound. The focus of this research was to study the waste waters coming from the gold mines containing leachate compound thiosulfate. Literature review contained also gold leaching process when cyanide is used as the leachate. Another objective of this work was to compare PCD process with other processes based on their energy efficiencies. In the experimental part two concentrations of sodium thiosulfate, 1000ppm and 400ppm, were used. Two pulse generator frequencies of 833 and 200 pulses per second (pps) were used. The chemical analyses of the samples taken during semi-batch PCD oxidation process were analyzed by ion chromatographic (IC). It is observed after the analyses that among different frequencies and concentrations, the most suitable ones for the process is 200pps and 1000ppm respectively because the pollutants present in the waste water has more time to react with the OH radicals which are the oxidants and the process is energy efficient compared to other frequencies.