996 resultados para Biopsies of the duodenum


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The effects of ionic strength on ions in aqueous solutions are quite relevant, especially for biochemical systems, in which proteins and amino acids are involved. The teaching of this topic and more specifically, the Debye-Hückel limiting law, is central in chemistry undergraduate courses. In this work, we present a description of an experimental procedure based on the color change of aqueous solutions of bromocresol green (BCG), driven by addition of electrolyte. The contribution of charge product (z+|z-|) to the Debye-Hückel limiting law is demonstrated when the effects of NaCl and Na2SO4 on the color of BCG solutions are compared.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Understanding the flow of diaspores is fundamental for determining plant population dynamics in a particular habitat, and a lack of seeds is a limiting factor in forest regeneration, especially in isolated forest fragments. Bamboo dominance affects forest structure and dynamics by suppressing or delaying the recruitment of and colonization by tree species as well as by inhibiting the survival and growth of adult trees. The goal of the present study was to determine whether dominance of the bamboo species Aulonemia aristulata (Döll) McClure in the forest understory influences species abundance and composition. We examined the seed rain at two noncontiguous sites (1.5 km apart) within an urban forest fragment, with and without bamboo dominance (BD+ and BD- areas, respectively). Sixty seed traps (0.5 m², with a 1-mm mesh) were set in the BD+ and BD- areas, and the seed rain was sampled from January to December 2007. Diaspores were classified according to dispersal syndrome, growth form and functional type of the species to which they belonged. There were significant differences between the two areas in terms of seed density, species diversity and dispersal syndrome. The BD+ area showed greater seed density and species diversity. In both areas, seed distribution was limited primarily by impaired dispersal. Bamboo dominance and low tree density resulted in fewer propagules in the seed rain. Our results suggest that low availability of seeds in the rain does not promote the maintenance of a degraded state, characterized by the presence of bamboo.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick) and polyethylene (29 and 7 μm thick) showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This in situ study investigated, using scanning electron microscopy, the effect of stimulated saliva on the enamel surface of bovine and human substrates submitted to erosion followed by brushing abrasion immediately or after one hour. During 2 experimental 7-day crossover phases, 9 previously selected volunteers wore intraoral palatal devices, with 12 enamel specimens (6 human and 6 bovine). In the first phase, the volunteers immersed the device for 5 minutes in 150 ml of a cola drink, 4 times a day (8h00, 12h00, 16h00 and 20h00). Immediately after the immersions, no treatment was performed in 4 specimens (ERO), 4 other specimens were immediately brushed (0 min) using a fluoride dentifrice and the device was replaced into the mouth. After 60 min, the other 4 specimens were brushed. In the second phase, the procedures were repeated but, after the immersions, the volunteers stimulated the salivary flow rate by chewing a sugar-free gum for 30 min. Enamel superficial alterations of all specimens were then evaluated using a scanning electron microscope. Enamel prism core dissolution was seen on the surfaces submitted to erosion, while on those submitted to erosion and to abrasion (both at 0 and 60 min) a more homogeneous enamel surface was observed, probably due to the removal of the altered superficial prism layer. For all the other variables - enamel substrate and salivary stimulation -, the microscopic pattern of the enamel specimens was similar.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

OBJECTIVES: This study assessed the bone density gain and its relationship with the periodontal clinical parameters in a case series of a regenerative therapy procedure. MATERIAL AND METHODS: Using a split-mouth study design, 10 pairs of infrabony defects from 15 patients were treated with a pool of bovine bone morphogenetic proteins associated with collagen membrane (test sites) or collagen membrane only (control sites). The periodontal healing was clinically and radiographically monitored for six months. Standardized pre-surgical and 6-month postoperative radiographs were digitized for digital subtraction analysis, which showed relative bone density gain in both groups of 0.034 ± 0.423 and 0.105 ± 0.423 in the test and control group, respectively (p>0.05). RESULTS: As regards the area size of bone density change, the influence of the therapy was detected in 2.5 mm² in the test group and 2 mm² in the control group (p>0.05). Additionally, no correlation was observed between the favorable clinical results and the bone density gain measured by digital subtraction radiography (p>0.05). CONCLUSIONS: The findings of this study suggest that the clinical benefit of the regenerative therapy observed did not come with significant bone density gains. Long-term evaluation may lead to a different conclusions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of the present study was to determine whether lesion of the subthalamic nucleus (STN) promoted by N-methyl-D-aspartate (NMDA) would rescue nigrostriatal dopaminergic neurons after unilateral 6-hydroxydopamine (6-OHDA) injection into the medial forebrain bundle (MFB). Initially, 16 mg 6-OHDA (6-OHDA group) or vehicle (artificial cerebrospinal fluid - aCSF; Sham group) was infused into the right MFB of adult male Wistar rats. Fifteen days after surgery, the 6-OHDA and SHAM groups were randomly subdivided and received ipsilateral injection of either 60 mM NMDA or aCSF in the right STN. Additionally, a control group was not submitted to stereotaxic surgery. Five groups of rats were studied: 6-OHDA/NMDA, 6-OHDA/Sham, Sham/NMDA, Sham/Sham, and Control. Fourteen days after injection of 6-OHDA, rats were submitted to the rotational test induced by apomorphine (0.1 mg/kg, ip) and to the open-field test. The same tests were performed again 14 days after NMDA-induced lesion of the STN. The STN lesion reduced the contralateral turns induced by apomorphine and blocked the progression of motor impairment in the open-field test in 6-OHDA-treated rats. However, lesion of the STN did not prevent the reduction of striatal concentrations of dopamine and metabolites or the number of nigrostriatal dopaminergic neurons after 6-OHDA lesion. Therefore, STN lesion is able to reverse motor deficits after severe 6-OHDA-induced lesion of the nigrostriatal pathway, but does not protect or rescue dopaminergic neurons in the substantia nigra pars compacta.