Familial partial epilepsy with variable foci: Clinical features and linkage to chromosome 22q12

Background: Familial partial epilepsy with variable foci (FPEVF) is an autosomal dominant syndrome characterized by partial seizures originating from different brain regions in different family members in the absence of detectable structural abnormalities. A gene for FPEVF was mapped to chromosome 22q12 in two distantly related French-Canadian families. Methods: We describe the clinical features and performed a linkage analysis in a Spanish kindred and in a third French-Canadian family distantly related to the original pedigrees. Results: Onset of seizures was typically in middle childhood, and attacks were usually easy to control. Seizure semiology varied among family members but was constant for each individual. In some, a pattern of nocturnal frontal lobe seizures led to consideration of the diagnosis of autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE). The Spanish family was mapped to chromosome 22q (multipoint lod score, 3.4), and the new French-Canadian family had a multipoint lod score of 2.97 and shared the haplotype of the original French-Canadian families. Conclusions: Identification of the various forms of familial partial epilepsy is challenging, particularly in small families, in which insufficient individuals exist to identify a specific pattern. We provide clinical guidelines for this task, which will eventually be supplanted by specific molecular diagnosis. We confirmed linkage of FPEVF to chromosome 22q 12 and redefined the region to a 5.2-Mb segment of DNA.

Reward drive and rash impulsiveness as dimensions of impulsivity: Implications for substance misuse

One of the primary personality dimensions or traits that has consistently been linked to substance abuse is impulsivity. However, impulsivity is not a homogenous construct and although many of the measures of impulsivity are correlated, the most recent review of published factor analytic studies has proposed two independent dimensions of impulsivity: reward sensitivity, reflecting one of the primary dimension of J. A. Gray's personality theory, and rash impulsiveness. These two facets of impulsivity derived from the field of personality research parallel recent developments in the neurosciences where changes in the incentive value of rewarding substances has been linked to alterations in neural substrates involved in reward seeking and with a diminished capacity to inhibit behavior due to chronic drug exposure. In this paper, we propose a model that integrates the findings from research into individual differences with recent models of neural substrates implicated in the development of substance misuse. (C) 2004 Elsevier Ltd. All rights reserved.

Variable effects of larval size on post-metamorphic performance in the field

Larval quality may be capable of explaining much of the variation in the recruitment and subsequent population dynamics of benthic marine invertebrates. Whilst the effects of larval nutritional condition on adult performance have received the most attention, recent work has shown that larval size may also be an important and ubiquitous source of variation in larval quality. We examined the effects of variation in larval size on the post-metamorphic survival and growth of Watersipora subtorquata in 2 very different habitats - experimental substrata and pier pilings. We found strong effects of larval size on colony performance, although these varied among experiments. For colonies on experimental substrata, larval size positively affected adult survival and, initially, growth. However, after 3 wk in the field, there was no relationship between larval size and colony size, possibly because colonies were completely surrounded by newly settled organisms. Larval size also positively affected post-metamorphic growth of colonies on pier pilings, but, surprisingly, colonies that came from larger larvae had lower survival than colonies from smaller larvae. Overall, variation in larval size will strongly affect the recruitment and subsequent performance of adults in this species, although this may vary among different habitats. This study highlights the importance of examining the effects of larval quality on adult performance in as realistic conditions as possible, because of the strong interaction between larval size effects and the environment.

Parametric analyses of anxiety in zebrafish scototaxis

Scototaxis, the preference for dark environments in detriment of bright ones, is an index of anxiety in zebrafish. In this work, we analyzed avoidance of the white compartment by analysis of the spatiotemporal pattern of exploratory behavior (time spent in the white compartment of the apparatus and shuttle frequency between compartments) and swimming ethogram (thigmotaxis, freezing and burst swimming in the white compartment) in four experiments. In Experiment 1, we demonstrate that spatiotemporal measures of white avoidance and locomotion do not habituate during a single 15-min session. In Experiments 2 and 3, we demonstrate that locomotor activity habituates to repeated exposures to the apparatus, regardless of whether inter-trial interval is 15-min or 24-h; however, no habituation of white avoidance was observed in either experiment. In Experiment 4, we confined animals for three 15-min sessions in the white compartment prior to recording spatiotemporal and ethogram measures in a standard preference test. After these forced exposures, white avoidance and locomotor activity showed no differences in relation to non-confined animals, but burst swimming, thigmotaxis and freezing in the white compartment were all decreased. These results suggest that neither avoidance of the white compartment nor approach to the black compartment account for the behavior of zebrafish in the scototaxis test. (C) 2010 Elsevier B.V. All rights reserved.

5 Hz repetitive TMS increases anticipatory motor activity in the human cortex

In the present study, we analyzed how high-frequency repetitive transcranial magnetic stimulation (rTMS) of the primary motor hand area (M1-Hand) shapes anticipatory motor activity in frontal areas as indexed by the contingent negative variation (CNV). Eight right-handed volunteers received real or sham 5 Hz rTMS at an intensity of 90% resting motorthreshold (1500 stimuli per session). Real but not sham rTMS to left M1-Hand induced a site-specific increase in amplitude of the late component of the CNV at the electrode C3 overlaying the site of stimulation. The increase in pre-movement activity in the stimulated cortex may reflect an increase in facilitatory drive from connected motor areas, enhanced responsiveness of the stimulated cortex to these inputs or both. (c) 2005 Elsevier Ireland Ltd. All rights reserved.

Selective Vagal Denervation of the Sinus and Atrioventricular Nodes, Guided by Vagal Reflexes Induced by High Frequency Stimulation, to Treat Refractory Neurally Mediated Syncope

Vagal Denervation and Neurally Mediated Syncope. A 15-year-old female patient presented with frequent episodes of vasovagal syncope refractory to non-pharmacological and pharmacological measures. Two tilt-table tests performed before and after conventional therapy were positive and reproduced the patient`s clinical symptoms. Selective vagal denervation, guided by HFS, was performed. Six radiofrequency pulses were applied on the left and right sides of the interatrial septum, abolishing vagal responses at these locations. Basal sinus node and Wenckebach cycle lengths changed significantly following ablation. A tilt test performed after denervation was negative and revealed autonomic tone modification. The patient reported significant improvement in quality of life and remained asymptomatic for 9 months after denervation. After this period, three episodes of NMS occurred during a 4-month interval and a tilt test performed 11 months after the procedure demonstrated vagal activity recovery. (J Cardiovasc Electrophysiol, Vol. 20, pp. 558-563, May 2009).

Abatacept in children with juvenile idiopathic arthritis: a randomised, double-blind, placebo-controlled withdrawal trial

Background Some children with juvenile idiopathic arthritis either do not respond, or are intolerant to, treatment with disease-modifying antirheumatic drugs, including anti-tumour necrosis factor (TNF) drugs. We aimed to assess the safety and efficacy of abatacept, a selective T-cell costimulation modulator, in children with juvenile idiopathic arthritis who had failed previous treatments. Methods We did a double-blind, randomised controlled withdrawal trial between February, 2004, and June, 2006. We enrolled 190 patients aged 6-17 years, from 45 centres, who had a history of active juvenile idiopathic arthritis; at least five active joints; and an inadequate response to, or intolerance to, at least one disease-modifying antirheumatic drug. All 190 patients were given 10 mg/kg of abatacept intravenously in the open-label period of 4 months. Of the 170 patients who completed this lead-in course, 47 did not respond to the treatment according to predefined American College of Rheumatology (ACR) paediatric criteria and were excluded. Of the patients who did respond to abatacept, arthritis, and 62 were randomly assigned to receive placebo at the same dose and timing. The primary endpoint was time to flare of arthritis. Flare was defined as worsening of 30% or more in at least three of six core variables, with at least 30% improvement in no more than one variable. We analysed all patients who were treated as per protocol. This trial is registered, number NCT00095173. Findings Flares of arthritis occurred in 33 of 62 (53%) patients who were given placebo and 12 of 60 (20%) abatacept patients during the double-blind treatment (p=0.0003). Median time to flare of arthritis was 6 months for patients given placebo (insufficient events to calculate IQR); insufficient events had occurred in the abatacept group for median time to flare to be assessed (p=0.0002). The risk of flare in patients who contined abatacept was less than a third of that for controls during that double-blind period (hazard ratio 0.31, 95% CI 0.16-0.95). During the double-blind period, the frequency of adverse events did not differ in the two treatment groups, Adverse events were recorded in 37 abatacept recipients (62%) and 34 (55%) placebo recipients (p=0.47); only two serious adverse events were reported, bouth in controls (p=0.50). Interpretation Selective modulation of T-cell costimulation with abatacept is a rational alternative treatment for children with juvenile idiopathic arthritis. Funding Bristol-Myers Squibb.

Three-dimensional model for multi-component reactive transport with variable density groundwater flow

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Tidal influence on behaviour of a coastal aquifer adjacent to a low-relief estuary

The tidal influence on groundwater hydrodynamics, salt-water intrusion and submarine groundwater discharge from coastal/estuarine aquifers is poorly quantified for systems with a mildly sloping beach, in contrast to the case where a vertical beach face is assumed. We investigated the effect of beach slope for a coastal aquifer adjacent to a low-relief estuary, where industrial waste was emplaced over the aquifer. The waste was suspected to discharge leachate towards the estuary. Field observations at various locations showed that tidally induced groundwater head fluctuations were skewed temporally. Frequency analysis suggested that the fluctuation amplitudes decreased exponentially and the phase-tags increased Linearly for the primary tidal signals as they propagated inland. Salinisation zones were observed in the bottom part of the estuary and near the beach surface. Flow and transport processes in a cross-section perpendicular to the estuary were simulated using SEAWAT-2000, which is capable of depicting density-dependent flow and multi-species transport. The simulations showed that the modelled water table fluctuations were in good agreement with the monitored data. Further simulations were conducted to gain insight into the effects of beach slope. In particular the limiting case of a vertical beach face was considered. The simulations showed that density difference and tidal forcing drive a more complex hydrodynamic pattern for the mildly sloping beach than the vertical beach, as well as a profound asymmetry in tidally induced water table fluctuations and enhanced salt-water intrusion. The simulation results also indicated that contaminant transport from the aquifer to the estuary was affected by the tide, where for the mildly sloping beach, the tide tended to intensify the vertical mass exchange in the vicinity of the shorelines, (c) 2005 Elsevier B.V. All rights reserved.

Neurological manifestations and ATP7B mutations in Wilson`s disease

Wilson`s disease (WD) is a rare inborn metabolic error characterized by deficient biliary copper excretion secondary to ATP7B gene mutations. Neurological presentations are variable in respect to both pattern and age of onset; commonly a movement disorder presents in the second or third decade. The aim of this study was to ascertain genotype correlations with distinct neurological manifestations in 41 WD patients in a Brazilian center for WD. A total of 23 distinct mutations were detected, and the frameshift 3402de1C had the highest allelic frequency (31.7%). An association between 3402de1C and dysphagia was detected (p = 0.01) but the limited number of patients is insufficient to allow one to draw conclusions. Both clinical studies analyzing larger cohorts and basic research on ATP7B protein function could potentially shed more light on our understanding of WD. (c) 2007 Elsevier Ltd. All rights reserved.

High Frequency of Lamivudine Resistance Mutations in Brazilian Patients Co-Infected With HIV and Hepatitis B

This study analyzed the genotype distribution and frequency of lamivudine (LAM) and tenofovir (TDF) resistance mutations in a group of patients co-infected with HIV and hepatitis B virus (HBV). A cross-sectional study of 847 patients with HIV was conducted. Patients provided blood samples for HBsAg detection. The load of HBV was determined using an ""in-house"" real-time polymerase chain reaction. HBV genotypes/subgenotypes, antiviral resistance, basal core promoter (BCP), and precore mutations were detected by DNA sequencing. Twenty-eight patients with co-infection were identified. The distribution of HBV genotypes among these patients was A (n = 9; 50%), D (n = 4; 22.2%), G (n = 3; 16.7%), and F (n = 2; 11.1%). Eighteen patients were treated with LAM and six patients were treated with LAM plus TDF. The length of exposure to LAM and TDF varied from 4 to 216 months. LAM resistance substitutions (rtL180M + rtM204V) were detected in 10 (50%) of the 20 patients with viremia. This pattern and an accompanying rtV173L mutation was found in four patients. Three patients with the triple polymerase substitution pattern (rtV173L+ rtL180M + rtM204V) had associated changes in the envelope gene (sE164D + sl195M). Mutations in the BCP region (A1762T, G1764A) and in the precore region (G1896A, G1899A) were also found. No putative TDF resistance substitution was detected. The data suggest that prolonged LAM use is associated with the emergence of particular changes in the HBV genome, including substitutions that may elicit a vaccine escape phenotype. No putative TDF resistance change was detected after prolonged use of TDF. J. Med. Virol. 82:1481-1488, 2010. (C) 2010 Wiley-Liss, Inc.

Reliability of multiple frequency bioelectrical impedance analysis: An intermachine comparison

The technical reliability (i.e., interinstrument and interoperator reliability) of three SEAC-swept frequency bioimpedance monitors was assessed for both errors of measurement and associated analyses. In addition, intraoperator and intrainstrument variability was evaluated for repeat measures over a 4-hour period. The measured impedance values from a range of resistance-capacitance circuits were accurate to within 3% of theoretical values over a range of 50-800 ohms. Similarly, phase was measured over the range 1 degrees-19 degrees with a maximum deviation of 1.3 degrees from the theoretical value. The extrapolated impedance at zero frequency was equally well determined (+/-3%). However, the accuracy of the extrapolated value at infinite frequency was decreased, particularly at impedances below 50 ohms (approaching the lower limit of the measurement range of the instrument). The interinstrument/operator variation for whole body measurements were recorded on human volunteers with biases of less than +/-1% for measured impedance values and less than 3% for phase. The variation in the extrapolated values of impedance at zero and infinite frequencies included variations due to operator choice of the analysis parameters but was still less than +/-0.5%. (C) 1997 Wiley-Liss, Inc.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Direct measurement of pulse distortion near the zero-dispersion wavelength in an optical fiber by frequency-resolved optical gating

The technique of frequency-resolved optical gating is used to characterize the intensity and the phase of picosecond pulses after propagation through 700 m of fiber at close to the zero-dispersion wavelength. Using the frequency-resolved optical gating technique, we directly measure the severe temporal distortion resulting from the interplay between self-phase modulation and higher-order dispersion in this regime. The measured intensity and phase of the pulses after propagation are found to be in good agreement with the predictions of numerical simulations with the nonlinear Schrodinger equation. (C) 1997 Optical Society of America.