Ccm1, a regulatory gene controlling the induction of a carbon-concentrating mechanism in Chlamydomonas reinhardtii by sensing CO2 availability

Aquatic photosynthetic organisms, including the green alga Chlamydomonas reinhardtii, induce a set of genes for a carbon-concentrating mechanism (CCM) to acclimate to CO2-limiting conditions. This acclimation is modulated by some mechanisms in the cell to sense CO2 availability. Previously, a high-CO2-requiring mutant C16 defective in an induction of the CCM was isolated from C. reinhardtii by gene tagging. By using this pleiotropic mutant, we isolated a nuclear regulatory gene, Ccm1, encoding a 699-aa hydrophilic protein with a putative zinc-finger motif in its N-terminal region and a Gln repeat characteristic of transcriptional activators. Introduction of Ccm1 into this mutant restored an active carbon transport through the CCM, development of a pyrenoid structure in the chloroplast, and induction of a set of CCM-related genes. That a 5,128-base Ccm1 transcript and also the translation product of 76 kDa were detected in both high- and low-CO2 conditions suggests that CCM1 might be modified posttranslationally. These data indicate that Ccm1 is essential to control the induction of CCM by sensing CO2 availability in Chlamydomonas cells. In addition, complementation assay and identification of the mutation site of another pleiotropic mutant, cia5, revealed that His-54 within the putative zinc-finger motif of the CCM1 is crucial to its regulatory function.

Unsaturated fatty acids inhibit transcription of the sterol regulatory element-binding protein-1c (SREBP-1c) gene by antagonizing ligand-dependent activation of the LXR

Sterol regulatory element-binding protein-1c (SREBP-1c) enhances transcription of genes encoding enzymes of unsaturated fatty acid biosynthesis in liver. SREBP-1c mRNA is known to increase when cells are treated with agonists of liver X receptor (LXR), a nuclear hormone receptor, and to decrease when cells are treated with unsaturated fatty acids, the end products of SREBP-1c action. Here we show that unsaturated fatty acids lower SREBP-1c mRNA levels in part by antagonizing the actions of LXR. In cultured rat hepatoma cells, arachidonic acid and other fatty acids competitively inhibited activation of the endogenous SREBP-1c gene by an LXR ligand. Arachidonate also blocked the activation of a synthetic LXR-dependent promoter in transfected human embryonic kidney-293 cells. In vitro, arachidonate and other unsaturated fatty acids competitively blocked activation of LXR, as reflected by a fluorescence polarization assay that measures ligand-dependent binding of LXR to a peptide derived from a coactivator. These data offer a potential mechanism that partially explains the long-known ability of dietary unsaturated fatty acids to decrease the synthesis and secretion of fatty acids and triglycerides in livers of humans and other animals.

Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance

The recently cloned NPR1 gene of Arabidopsis thaliana is a key regulator of acquired resistance responses. Upon induction, NPR1 expression is elevated and the NPR1 protein is activated, in turn inducing expression of a battery of downstream pathogenesis-related genes. In this study, we found that NPR1 confers resistance to the pathogens Pseudomonas syringae and Peronospora parasitica in a dosage-dependent fashion. Overexpression of NPR1 leads to enhanced resistance with no obvious detrimental effect on the plants. Thus, for the first time, a single gene is shown to be a workable target for genetic engineering of nonspecific resistance in plants.

Alternatively spliced mRNAs predicted to yield frame-shift proteins and stable intron 1 RNAs of the herpes simplex virus 1 regulatory gene alpha 0 accumulate in the cytoplasm of infected cells.

The infected cell protein no. 0 (ICP0), the product of the alpha 0 gene, and an important herpes simplex virus 1 regulatory protein is encoded by three exons. We report that intron 1 forms a family of four stable nonpolyadenylylated cytoplasmic RNAs sharing a common 5' end but differing in 3' ends. The 5' and 3' ends correspond to the accepted splice donor and four splice acceptor sites within the mapped intron domain. The most distant splice acceptor site yields the mRNA encoding the 775-aa protein known as ICP0. The mRNAs resulting from the use of alternative splice acceptor sites were also present in the cytoplasm of infected cells and would be predicted to encode proteins of 152 (ICP0-B), 87 (ICP0-C), and 90 (ICP0-D) amino acids, respectively. Both the stability of the alpha 0 mRNA and the utilization of at least one splice acceptor site was regulated by ICP22 and or US1.5 protein inasmuch as cells infected with a mutant from which these genes had been deleted accumulated smaller amounts of alpha 0 mRNA than would be predicted from the amounts of accumulated intron RNAs. In addition, one splice acceptor site was at best underutilized. These results indicate that both the splicing pattern and longevity of alpha 0 mRNA are regulated. These and other recent examples indicate that herpes simplex virus 1 regulates its own gene expression and that of the infected cells through control of mRNA splicing and longevity.

Sterol regulatory element binding protein binds to a cis element in the promoter of the farnesyl diphosphate synthase gene.

Sterol-regulated transcription of the gene for rat farnesyl diphosphate (FPP) synthase (geranyl-diphosphate:isopentenyl-diphosphate geranyltranstransferase, EC 2.5.1.10) is dependent in part on the binding of the ubiquitous transcription factor NF-Y to a 6-bp element within the proximal promoter. Current studies identify a second element in this promoter that is also required for sterol-regulated transcription in vivo. Mutation of three nucleotides (CAC) within this element blocks the 8-fold induction of FPP synthase promoter-reporter genes that normally occurs when the transfected cells are incubated in medium deprived of sterols. Gel mobility-shift assays demonstrate that the transcriptionally active 68-kDa fragment of the sterol regulatory element (SRE-1)-binding protein assays (SREBP-1) binds to an oligonucleotide containing the wild-type sequence but not to an oligonucleotide in which the CAC has been mutated. DNase 1 protection pattern (footprint) analysis indicates that SREBP-1 binds to nucleotides that include the CAC. Both the in vivo and in vitro assays are affected by mutagenesis of nucleotides adjacent to the CAC. Coexpression of SREBP with a wild-type FPP synthase promoter-reporter gene in CV-1 cells results in very high levels of reporter activity that is sterol-independent. In contrast, the reporter activity remained low when the promoter contained a mutation in the CAC trinucleotide. We conclude that sterol-regulated transcription of FPP synthase is controlled in part by the interaction of SREBP with a binding site that we have termed SRE-3. Identification of this element may prove useful in the identification of other genes that are both regulated by SREBP and involved in lipid biosynthesis.

UME6 is a central component of a developmental regulatory switch controlling meiosis-specific gene expression.

The UME6 gene of Saccharomyces cerevisiae was identified as a mitotic repressor of early meiosis-specific gene expression. It encodes a Zn2Cys6 DNA-binding protein which binds to URS1, a promoter element needed for both mitotic repression and meiotic induction of early meiotic genes. This paper demonstrates that a complete deletion of UME6 causes not only vegetative derepression of early meiotic genes during vegetative growth but also a significant reduction in induction of meiosis-specific genes, accompanied by a severe defect in meiotic progression. After initiating premeiotic DNA synthesis the vast majority of cells (approximately 85%) become arrested in prophase and fail to execute recombination; a minority of cells (approximately 15%) complete recombination and meiosis I, and half of these form asci. Quantitative analysis of the same early meiotic transcripts that are vegetatively derepressed in the ume6 mutant, SPO11, SPO13, IME2, and SPO1, indicates a low level of induction in meiosis above their vegetative derepressed levels. In addition, the expression of later meiotic transcripts, SPS2 and DIT1, is significantly delayed and reduced. The expression pattern of early meiotic genes in ume6-deleted cells is strikingly similar to that of early meiotic genes with promoter mutations in URS1. These results support the view that UME6 and URS1 are part of a developmental switch that controls both vegetative repression and meiotic induction of meiosis-specific genes.

Gut-specific transcriptional regulatory elements of the carboxypeptidase gene are conserved between black flies and Drosophila.

Millions of people die every year in the tropical world from diseases transmitted by hematophagous insects. Failure of conventional containment measures emphasizes the need for additional approaches, such as transformation of vector insects with genes that restrict vectorial capacity. The availability of an efficient promoter to drive foreign genes in transgenic insects is a necessary tool to test the feasibility of such approach. Here we characterize the putative promoter region of a black fly midgut carboxypeptidase gene and show that these sequences correctly direct the expression of a beta-glucuronidase reporter in Drosophila melanogaster. By histochemical staining and mRNA analysis, we found that the gene is expressed strongly and gut-specifically in the transgenic Drosophila. This gut-specific black fly carboxypeptidase promoter provides a valuable tool for the study of disease vectors.

Human steroidogenic acute regulatory protein: functional activity in COS-1 cells, tissue-specific expression, and mapping of the structural gene to 8p11.2 and a pseudogene to chromosome 13.

Steroidogenic acute regulatory protein (StAR) appears to mediate the rapid increase in pregnenolone synthesis stimulated by tropic hormones. cDNAs encoding StAR were isolated from a human adrenal cortex library. Human StAR, coexpressed in COS-1 cells with cytochrome P450scc and adrenodoxin, increased pregnenolone synthesis > 4-fold. A major StAR transcript of 1.6 kb and less abundant transcripts of 4.4 and 7.5 kb were detected in ovary and testis. Kidney had a lower amount of the 1.6-kb message. StAR mRNA was not detected in other tissues including placenta. Treatment of granulosa cells with 8-bromo-adenosine 3',5'-cyclic monophosphate for 24 hr increased StAR mRNA 3-fold or more. The structural gene encoding StAR was mapped using somatic cell hybrid mapping panels to chromosome 8p. Fluorescence in situ hybridization placed the StAR locus in the region 8p11.2. A StAR pseudogene was mapped to chromosome 13. We conclude that StAR expression is restricted to tissues that carry out mitochondrial sterol oxidations subject to acute regulation by cAMP and that StAR mRNA levels are regulated by cAMP.

Regulatory region in choline acetyltransferase gene directs developmental and tissue-specific expression in transgenic mice.

Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.

Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF) 1 genes reveal evolutionary conservation in the IRF gene family.

Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.

The sulfur controller-2 negative regulatory gene of Neurospora crassa encodes a protein with beta-transducin repeats.

The sulfur regulatory system of Neurospora crassa is composed of a set of structural genes involved in sulfur catabolism controlled by a genetically defined set of trans-acting regulatory genes. These sulfur regulatory genes include cys-3+, which encodes a basic region-leucine zipper transcriptional activator, and the negative regulatory gene scon-2+. We report here that the scon-2+ gene encodes a polypeptide of 650 amino acids belonging to the expanding beta-transducin family of eukaryotic regulatory proteins. Specifically, SCON2 protein contains six repeated G beta-homologous domains spanning the C-terminal half of the protein. SCON2 represents the initial filamentous fungal protein identified in the beta-transducin group. Additionally, SCON2 exhibits a specific amino-terminal domain that potentially defines another subfamily of beta-transducin homologs. Expression of the scon-2+ gene has been examined using RNA hybridization and gel mobility-shift analysis. The dependence of scon-2+ expression on CYS3 function and the binding of CYS3 to the scon-2+ promoter indicate the presence of an important control loop within the N. crassa sulfur regulatory circuit involving CYS3 activation of scon-2+ expression. On the basis of the presence of beta-transducin repeats, the crucial role of SCON2 in the signal-response pathway triggered by sulfur limitation may be mediated by protein-protein interactions.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Identification of two evolutionarily conserved and functional regulatory elements in intron 2 of the human BRCA1 gene

Cross-species comparative genomics is a powerful strategy for identifying functional regulatory elements within noncoding DNA. In this paper, comparative analysis of human and mouse intronic sequences in the breast cancer susceptibility gene (BRCA1) revealed two evolutionarily conserved noncoding sequences (CNS) in intron 2, 5 kb downstream of the core BRCA1 promoter. The functionality of these elements was examined using homologous-recombination-based mutagenesis of reporter gene-tagged cosmids incorporating these regions and flanking sequences from the BRCA1 locus. This showed that CNS-1 and CNS-2 have differential transcriptional regulatory activity in epithelial cell lines. Mutation of CNS-1 significantly reduced reporter gene expression to 30% of control levels. Conversely mutation of CNS-2 increased expression to 200% of control levels. Regulation is at the level of transcription and shows promoter specificity. Both elements also specifically bind nuclear proteins in vitro. These studies demonstrate that the combination of comparative genomics and functional analysis is a successful strategy to identify novel regulatory elements and provide the first direct evidence that conserved noncoding sequences in BRCA1 regulate gene expression. (c) 2005 Elsevier Inc. All rights reserved.

The prion protein gene: Identifying regulatory signals using marsupial sequence

The function of the prion protein gene (PRNP) and its normal product PrPC is elusive. We used comparative genomics as a strategy to understand the normal function of PRNP. As the reliability of comparisons increases with the number of species and increased evolutionary distance, we isolated and sequenced a 66.5 kb BAC containing the PRNP gene from a distantly related mammal, the model Australian marsupial Macropus eugenii (tammar wallaby). Marsupials are separated from eutherians such as human and mouse by roughly 180 million years of independent evolution. We found that tammar PRNP, like human PRNP, has two exons. Prion proteins encoded by the tammar wallaby and a distantly related marsupial, Monodelphis domestica (Brazilian opossum) PRNP contain proximal PrP repeats with a distinct, marsupial-specific composition and a variable number. Comparisons of tammar wallaby PRNP with PRNPs from human, mouse, bovine and ovine allowed us to identify non-coding gene regions conserved across the marsupial-eutherian evolutionary distance, which are candidates for regulatory regions. In the PRNP 3' UTR we found a conserved signal for nuclear-specific polyadenylation and the putative cytoplasmic polyadenylation element (CPE), indicating that post-transcriptional control of PRNP mRNA activity is important. Phylogenetic footprinting revealed conserved potential binding sites for the MZF-1 transcription factor in both upstream promoter and intron/intron 1, and for the MEF2, MyTI, Oct-1 and NFAT transcription factors in the intron(s). The presence of a conserved NFAT-binding site and CPE indicates involvement of PrPC in signal transduction and synaptic plasticity. (c) 2004 Elsevier B.V. All rights reserved.