953 resultados para alfa angle


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Na busca por novos materiais, foram sintetizados uma série de terpolímeros de etilenopropileno –α-olefinas superiores (1-hexeno, 1-deceno e 1-octadeceno) usando o sistema catalítico rac-Et[Ind]2ZrCl2/MAO. A razão entre E/P foi variada e duas concentrações de termonômeros foram estudadas. Neste trabalho foram apresentados os resultados qualitativos e quantitativos da caracterização desses terpolímeros através da técnica de ressonância magnética de carbono 13 (RMN de 13C). Foram apresentados os deslocamentos químicos observados e devidamente identificados, assim como a análise quantitativa da distribuição das tríades, do comprimento médio de unidades consecutivas e das razões de reatividade. O efeito da adição de uma olefina de cadeia longa ao sistema etileno-propileno foi avaliado através dos resultados obtidos da atividade catalítica, teor de incorporação, nas propriedades térmicas, na massa molar e propriedades mecânicas. Também foi realizado um estudo da heterogeneidade de algumas amostras através do fracionamento por eluição com gradiente de temperatura (TREF). O sistema rac-Et[Ind]2ZrCl2/MAO mostrou-se eficiente na terpolimerização do etileno e a técnica de RMN de 13C permitiu a completa caracterização de todos os terpolímeros obtidos. Esses terpolímeros mostraram-se como um sistema complexo onde foi possível observar que, dependendo do tipo de olefina que irá coordenar no sítio ativo do rac- Et[Ind]2ZrCl2/MAO, haverá mudanças significativas nas atividade e nas propriedades desses materiais. Verificou-se que as três α-olefinas superiores estudadas foram incorporadas a cadeia polimérica, sendo que na maioria dos casos a α-olefina mais incorporada foi o 1-octadeceno nas duas concentrações de termonômero analisadas. O aumento da incorporação de propeno acarreta uma diminuição no teor de termonômero incorporado. A incorporação do propeno acarreta uma diminuição das unidades cristalizáveis de etileno, provocando um decréscimo na temperatura de fusão, com o aumento da incorporação de propeno ocorre um aumento das seqüências de propeno cristalizáveis e conseqüentemente a temperatura de fusão. A massa molecular também diminui devido ao aumento das reações de terminação por β-eliminação de hidreto. Observou-se que os terpolímero apresentaram um módulo menor do que os copolímeros. Esses terpolímeros estudados apresentaram um comportamento elastomérico, podendo ser classificados como Elastômeros Termoplásticos.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A atividade física intensa pode induzir resposta inflamatória subclínica e aumento nos níveis plasmáticos de citocinas pró-inflamatórias. O objetivo deste estudo foi avaliar a relação entre a liberação de citocinas (IL-1β, IL-6, e TNF-α), o exercício físico agudo e o exercício regular em pacientes com doença pulmonar obstrutiva crônica (DPOC). Foram estudados 18 pacientes do sexo masculino com DPOC moderada a muito grave, divididos em dois grupos: 11 pacientes foram incluídos em programa de reabilitação pulmonar (RP) durante 8 semanas e 7 pacientes sem atividade física regular foram incluídos como grupo controle (C). Todos os pacientes realizaram espirometria, teste de exercício cardiopulmonar incremental máximo e teste de endurance em cicloergômetro com carga constante (60% da carga máxima do teste incremental) no início do projeto e após oito semanas. Foi coletado sangue venoso periférico para dosagem de citocinas, antes e 15 minutos após os testes de endurance (TE1 e TE2). IL-1β, IL-6, e TNF-α foram dosadas com kits ELISA específicos (Quantikine®, R&D Systems). Os pacientes submetidos à RP liberaram menos IL-1β que os controles após o treinamento (RP: TE1 0,96±0,66; TE2 -0,24±0,27 pg/ml; grupo C: TE1 -1,48±1,14; TE2 0,66±0,61 pg/ml; p=0,03). Não houve diferença significativa na liberação de IL-6 quando comparados os dois testes de endurance (RP: TE1 0,44±1,21; TE2 0,80±1,24 pg/ml; grupo C: TE1 0,88±0,85; TE2 0,78±0,95 pg/ml; p=0,68). Não foi observada diferença na liberação de IL-6 entre os dois grupos. Apenas cinco pacientes (quatro no grupo da RP) liberaram TNF-α e o exercício não modificou o seu padrão de liberação (RP: TE1 2,86±1,18; TE2 2,57±1,37pg/ml; grupo C: TE1 4,98; TE2 6,84 pg/ml; p=0,14). Não houve associação significativa entre intensidade de exercício e liberação de citocinas (IL-1β r=0,10; IL-6 r=-0,23). Houve maior liberação de IL-6 após o TE2 nos pacientes que apresentaram exacerbação da DPOC (exacerbados 9,59±1,32; estáveis 6,31±0,92 pg/ml; p=0,03) e não houve diferença nos níveis de IL-1β. Apenas pacientes com exacerbação da DPOC liberaram TNF-α (2,82±1,48 pg/ml). Concluiu-se que o exercício físico regular reduz a liberação de IL-1β e as exacerbações estimulam a liberação de IL-6 e TNF-α em pacientes com DPOC.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The vitamins A and E are recognizably important in the initial stages of life and the newborn depends on nutritional adequacy of breast milk to meet their needs. These vitamins share routes of transport to the tissues and antagonistic effects have been observed in animals after supplementation with vitamin A. This study aimed to verify the effect of maternal supplementation with vitamin A megadose (200,000 UI) in the immediate post-partum on the concentration of alpha-tocopherol in colostrum. Healthy parturient women attended at a public maternity natalensis were recruited for the study and divided into two groups: control (n = 37) and supplemented (n = 36). Blood samples of colostrum and milk were collected until 12 hours after delivery. The women of the supplemented group was administered a retynil palmitate capsule and 24 hours after the first collection was obtained the 2nd sample of colostrum in two groups for analysis of retinol and alpha-tocopherol in milk. The mean retinol concentration of 50,7 ± 14,4 μg/dL (Mean ± standard deviation) and alpha-tocopherol of 1217.4 ± 959 mg/dL in the serum indicate the nutritional status biochemical appropriate. Supplementation with retynil palmitate resulted in increase not only retinol levels in the colostrum of the supplemented group (p = 0.002), but also the concentration of alpha-tocopherol (p = 0.04), changing from 1456.6 ± 1095.8 mg/dL to 1804.3 ± 1432.0 mg/dL (milk 0 and 24 respectively) compared to values in the control group, 984.6 ± 750.0 mg/dL and 1175.0 ± 730.8 mg/dL. The women had different responses to supplementation, influenced by baseline levels of retinol in colostrum. Those with previous by low levels of retinol in colostrum (<60 mg/dL) had increased the concentration of alpha-tocopherol in milk, whereas those with adequate levels (> 60 mg/dL), showed a reduction after supplementation. Supplementation with retinol palmitate is an important intervention in situations of high risk for vitamin A deficiency, when considering the need to maternal supplementation, since the excess vitamin can offer unfavorable interactions between nutrients essential for the mother-child group

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Malnutrition, inflammation and comorbidities are frequent in patients with chronic renal failure in hemodialysis (HD), contributing for morbidity and mortality. Aims: To evaluate the correlation between anthropometric, laboratory parameters, bioelectrical impedance (BIA) and inflammatory markers with the morbidity and mortality of patients in HD, as well as the impact of its alterations throughout 12 months. Methods: 143 patients of a dialysis facility in Northeast Brazil were evaluated throughout 18 months. Patients with more than 3 months on dialysis, older than 18 years, without amputation of hands and feet, were included in the study. We performed a clinical (subjective global assessment - SGA), anthropometric (BMI, percent of ideal weight, MAC, MAMC, MAMA, percent of fat mass and TSF), laboratory (albumin, creatinine, lymphocyte count as nutritional markers and CRP, IL-6 and TNF- as inflammatory markers) evaluation and BIA (reactance, phase angle and percent of body cell mass) at the beginning of study and after 3, 6 and 12 months of follow-up. The association between study variables and deaths and hospitalizations in 6 and 12 months was investigated. The variable with significance < 10% in the univariate analysis had been enclosed in a multivariate logistic regression analysis. We also investigated the risk of mortality and hospitalization associated with differences in measurements of the variables at baseline and six months later. Results: Patients were aged 52.2 ± 16.6 years on the average, 58% were male, and mean dialysis vintage was 5.27 ± 5.12 years. The prevalence of malnutrition varied from 7.7-63.6%, according to the nutritional marker. The variables associated with morbidity and mortality in 6 and 12 months had been creatinine ≤ 9.45 mg/dl, phase angle ≤ 4.57 degrees, BMI ≤ 23 kg/m2, age ≤ 64.9 years, reactance ≤ 51.7 ohms; Charlson´s index ≥ 4 and socioeconomic status ≤ 7. During six months of follow up, decrease in albumin was associated with significantly higher mortality risk. Conclusions: This study detected that the best predictors of morbidity and mortality between nutritional and inflammatory markers are phase angle, reactance, creatinine and BMI and that changes in albumin values over six 107 months provide additional prognostic information. The authors believe that parameters of BIA may detect early changes in nutritional status and emphasize that longitudinal studies with larger number of patients are necessary to confirm these data and to recommend BIA as a routine nutritional evaluation in HD patients

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior

Relevância:

20.00% 20.00%

Publicador:

Resumo:

No presente trabalho, foram utilizadas 21 fêmeas suínas, virgens, sexualmente aptas, criadas e mantidas sob condições industriais, para observação dos perfis hormonais séricos de 17-alfa-OH progesterona e androstenediona, durante o ciclo estral. As colheitas de sangue foram efetuadas sempre no mesmo intervalo, entre 8 e 10 horas. Cada animal foi submetido a 14 punções venosas, distribuídas nos dias zero, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 22 e 23 do ciclo estral. Considerou-se o dia zero como o primeiro dia da fase estral, e o 23º dia como o primeiro do estro subseqüente. Os ensaios para dosagens hormonais foram executados utilizando-se a técnica de radioimunoensaio (RIE) em fase sólida e para isso foi empregado conjunto de reagentes comerciais (Coat-A-Count®). Para o hormônio 17-alfa-OH progesterona, foram encontrados valores médios que variaram entre 0,18 e 2,7 ng/ml e para o hormônio androstenediona esses valores oscilaram entre 0,08 e 0,24 ng/ml.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Alpha-lipoic acid (ALA) is a potent antioxidant with favourable anti-inflammatory, metabolic and endothelial effects, and has been widely investigated due to its potential against cardiovascular risk factors. This study aimed to evaluate the effect of oral ALA supplementation on oxidative stress biomarkers, inflammation and cardiovascular risk factors in patients with hypertension. This is a double-blind placebo-controlled randomized clinical trial, where the intervention was evaluated prospectively comparing results in both groups. The sample consisted of 64 hypertensive patients who were randomly distributed into ALA group (n = 32), receiving 600 mg / day ALA for twelve weeks and control group (n = 32), receiving placebo for the same period. The following parameters were evaluated before and after intervention: lipid peroxidation, content of reduced glutathione (GSH), enzymatic activities of glutathione peroxidase (GPx) and superoxide dismustase, ultrasensitive C-reactive protein (hs-CRP), triglycerides, total cholesterol and fractions, fasting glucose and anthropometric indicators. There was a statistically significant reduction (p <0.05) in serum concentrations of total cholesterol, very low density lipoprotein (VLDL), high density lipoprotein (HDL), triglycerides and blood glucose. There was a reduction in body weight and waist, abdominal and hip circumferences in the group that received ALA. In addition, there was a statistically significant increase (p <0.05) in the contents of reduced glutathione (GSH) and glutathione peroxidase (GPx) in the group receiving ALA. Oral administration of ALA appears to be a valuable adjuvant therapy, which may contribute to decrease the damage caused by oxidative stress and other risk factors associated with the atherosclerotic process

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This master's thesis aims to ascertain how the Stakeholders interactions influence the adoption of green marketing strategies from the perspective of the Alpha Company, a furniture industry located in Rio Grande do Norte, Brazil. The methodology has a qualitative approach and uses the exploratorydescriptive case study method as model of formal and systematic study. Following the theoretical and conceptual propositions of Polonsky (1995), Michell, Angle and Wood (1997) and Frooman (1999) as a reference base. This study identifies and assesses the importance degree of the relevant stakeholders, shows their expectations and needs and describes the tactics used by the company for the implementation of green marketing strategies. The study describes the reality of a furniture industry in Rio Grande do Norte, and shows his philosophy and background; identifies present stakeholders that influence the decision process of the company and also, analyzes the degree of importance of each group showing their needs and expectations and, finally, it states the changes in the organization with the implementation of green marketing strategies. The results it s concluded that stakeholders are taken into consideration in the adoption of green marketing strategies, even without a proper strategic perception from the company, an imperative to advance towards the adoption of the green marketing philosophy. This case study explores knowledge that may be used and suited to small companies that act in the strategic segment-trend of green marketing

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)