972 resultados para Site-selection
Resumo:
Inhibitors of proteolytic enzymes (proteases) are emerging as prospective treatments for diseases such as AIDS and viral infections, cancers, inflammatory disorders, and Alzheimer's disease. Generic approaches to the design of protease inhibitors are limited by the unpredictability of interactions between, and structural changes to, inhibitor and protease during binding. A computer analysis of superimposed crystal structures for 266 small molecule inhibitors bound to 48 proteases (16 aspartic, 17 serine, 8 cysteine, and 7 metallo) provides the first conclusive proof that inhibitors, including substrate analogues, commonly bind in an extended beta-strand conformation at the active sites of all these proteases. Representative superimposed structures are shown for (a) multiple inhibitors bound to a protease of each class, (b) single inhibitors each bound to multiple proteases, and (c) conformationally constrained inhibitors bound to proteases. Thus inhibitor/substrate conformation, rather than sequence/composition alone, influences protease recognition, and this has profound implications for inhibitor design. This conclusion is supported by NMR, CD, and binding studies for HIV-1 protease inhibitors/ substrates which, when preorganized in an extended conformation, have significantly higher protease affinity. Recognition is dependent upon conformational equilibria since helical and turn peptide conformations are not processed by proteases. Conformational selection explains the resistance of folded/structured regions of proteins to proteolytic degradation, the susceptibility of denatured proteins to processing, and the higher affinity of conformationally constrained 'extended' inhibitors/substrates for proteases. Other approaches to extended inhibitor conformations should similarly lead to high-affinity binding to a protease.
Resumo:
Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.
Resumo:
NMR solution structures are reported for two mutants (K16E, K16F) of the soluble amyloid beta peptide A beta(1-28). The structural effects of these mutations of a positively charged residue to anionic and hydrophobic residues at the alpha-secretase cleavage site (Lys16-Leu17) were examined in the membrane-simulating solvent aqueous SDS micelles. Overall the three-dimensional structures were similar to that for the native A beta(1-28) sequence in that they contained an unstructured N-terminus and a helical C-terminus. These structural elements are similar to those seen in the corresponding regions of full-length A beta peptides A beta(1-40) and A beta(1-42), showing that the shorter peptides are valid model systems. The K16E mutation, which might be expected to stabilize the macrodipole of the helix, slightly increased the helix length (residues 13-24) relative to the K16F mutation, which shortened the helix to between residues 16 and 24. The observed sequence-dependent control over conformation in this region provides an insight into possible conformational switching roles of mutations in the amyloid precursor protein from which A beta peptides are derived. In addition, if conformational transitions from helix to random coil to sheet precede aggregation of A beta peptides in vivo, as they do in vitro, the conformation-inducing effects of mutations at Lys16 may also influence aggregation and fibril formation. (C) 2000 Academic Press.
Resumo:
The 3-dimensionaI structure determination of rat phenylalanine hydroxylase (PAH) has identified potentially important amino acids lining the active site cleft with the majority of these having hydrophobic side-chains including several with aromatic side chains. Here we have analyzed the effect on rat PAH enzyme kinetics of in vitro mutagenesis of a number of these amino acids lining the PAH active site. Mutation of F299, Y324, F331, and Y343 caused a significant decrease in enzyme activity but no change in the K-m for substrate or cofactor. me conclude that these aromatic residues are essential for activity but are not significantly involved in binding of the substrate or cofactor. in contrast the PAH mutant, S349T, showed an 18-fold increase in K-m for phenylalanine, showing the first functional evidence that this residue was binding at or near the phenylalanine binding site. This confirms the recently published model for the binding of phenylalanine to the PAH active site that postulated S349 interacts with the amino group on the main chain of the phenylalanine molecule. This result differs with that found for the equivalent mutation (S395T), in the closely related tyrosine hydroxylase, which had no effect on substrate K-m, showing that while the architecture of the two active sites are very similar the amino acids that bind to the respective substrates are different. (C) 2000 Academic Press.
Resumo:
Background: Syphilis remains a significant cause of preventable perinatal death in developing countries with many women remaining untested and thus untreated. Syphilis testing in the clinic (on-site testing) may be a useful strategy to overcome this. We studied the impact of on-site syphilis testing on treatment delays and rates, and perinatal mortality. Methods: We conducted a cluster randomised controlled trial among seven pairs of primary healthcare clinics in rural South Africa, comparing on-site testing complemented by laboratory confirmation versus laboratory testing alone. Intervention clinics used the on-site test conducted by primary care nurses, with results and treatment available within an hour. Control clinics sent blood samples to the provincial laboratory, with results returned 2 weeks later. Results: Of 7134 women seeking antenatal care with available test results, 793 (11.1%) tested positive for syphilis. Women at intervention clinics completed treatment 16 days sooner on average (95% confidence interval: 11 to 21), though there was no significant difference in the proportion receiving adequate treatment at intervention (64%) and control (69%) clinics. There was also no significant difference in the proportion experiencing perinatal loss (3.3% v 5.1%; adjusted risk difference: -0.9%; 95% Cl -4.4 to 2.7). Conclusions: Despite reducing treatment delays, the addition of on-site syphilis testing to existing laboratory testing services did not lead to higher treatment rates or reduce perinatal mortality. However on-site testing for syphilis may remain an important option for improving antenatal care in settings where laboratory facilities are not available.
Resumo:
The crystal structure of six functionally-distinct enzymes of the DMSO reductase family of molybdenum enzymes has revealed that the tertiary structure of the polypeptide that binds the bis(MGD)Mo cofactor is highly conserved. Differences in the catalytic properties of enzymes of this family are almost certainly dependent upon differences in the structure ofthe MO active site. In DMSO reductase from Rhodobacter species tryptophan- 116 (W 116) hydrogen-bonds to an 0x0 group coordinated to the MO ion. In addition a second amino acid side chain from tyrosine-114 (Y 114) is in close proximity to the 0x0 group. We have investigated the role of Y 114 and W 116 in DMSO reductase using site-directed mutagenesis,
Resumo:
One consistent functional imaging finding from patients with major depression has been abnormality of the anterior cingulate cortex (ACC). Hypoperfusion has been most commonly reported, but some studies suggest relative hyperperfusion is associated with response to somatic treatments. Despite these indications of the possible importance of the ACC in depression there have been relatively few cognitive studies ACC function in patients with major depression. The present study employed a series of reaction time (RT) tasks involving selection with melancholic and nonmelancholic depressed patients, as well as age-matched controls. Fifteen patients with unipolar major depression (7 melancholic, 8 nonmelancholic) and 8 healthy age-matched controls performed a series of response selection tasks (choice RT, spatial Stroop, spatial stimulus-response compatibility (SRC), and a combined Stroop + SRC condition). Reaction time and error data were collected. Melancholic patients were significantly slower than controls on all tasks but were slower than nonmelancholic patients only on the Stroop and Stroop + SRC conditions. Nonmelancholic patients did not differ from the control group on any task. The Stroop task seems crucial in differentiating the two depressive groups, they did not differ on the choice RT or SRC tasks. This may reflect differential task demands, the SRC involved symbolic manipulation that might engage the dorsal ACC and dorsolateral prefrontal cortex (DLPFC) to a greater extent than the, primarily inhibitory, Stroop task which may engage the ventral ACC and orbitofrontal cortex (OFC). This might suggest the melancholic group showed a greater ventral ACC-OFC deficit than the nonmelancholic group, while both groups showed similar dorsal ACC-DLPFC deficit.
Resumo:
Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.
Resumo:
Purpose - The purpose of this paper is to verify if Brazilian companies are adopting environmental requirements in the supplier selection process. Further, this paper intends to analyze whether there is a relation between the level of environmental management maturity and the inclusion of environmental criteria in the companies` selection of suppliers. Design/methodology/approach - A review of mainstream literature on environmental management, traditional criteria in the supplier selection process and the incorporation of environmental requirements in this context. The empirical study`s strategy is based on five Brazilian case studies with industrial companies. Face-to-face interviews and informal conversations are to be held, explanations made by e-mail with representatives from the purchasing, environmental management, logistics and other areas, and observation and the collection of company documents are also employed. Findings - Based on the cases, it is concluded that companies still use traditional criteria to select suppliers, such as quality and cost, and do not adopt environmental requirements in the supplier selection process in a uniform manner. Evidence found shows that the level of environmental management maturity influences the depth with which companies adopt environmental criteria when selecting suppliers. Thus, a company with more advanced environmental management adopts more formal procedures for selecting environmentally appropriate suppliers than others. Originality/value - This is the first known study to verify if Brazilian companies are adopting environmental requirements in the supplier selection process.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
The selection of intended actions and the observation of others' actions: A time-resolved fMRI study
Resumo:
Whenever we plan, imagine, or observe an action, the motor systems that would be involved in preparing and executing that action are similarly engaged. The way in which such common motor activation is formed, however, is likely to differ depending on whether it arises from our own intentional selection of action or from the observation of another's action. In this study, we use time-resolved event-related functional MRI to tease apart neural processes specifically related to the processing of observed actions, the selection of our own intended actions, the preparation for movement, and motor response execution. Participants observed a finger gesture movement or a cue indicating they should select their own finger gesture to perform, followed by a 5-s delay period; participants then performed the observed or self-selected action. During the preparation and readiness for action, prior to initiation, we found activation in a common network of higher motor areas, including dorsal and ventral premotor areas and the pre-supplementary motor area (pre-SMA); the more caudal SMA showed greater activation during movement execution. Importantly, the route to this common motor activation differed depending on whether participants freely selected the actions to perform or whether they observed the actions performed by another person. Observation of action specifically involved activation of inferior and superior parietal regions, reflecting involvement of the dorsal visual pathway in visuomotor processing required for planning the action. In contrast, the selection of action specifically involved the dorsal lateral prefrontal and anterior cingulate cortex, reflecting the role of these prefrontal areas in attentional selection and guiding the selection of responses. (c) 2005 Elsevier Inc. All rights reserved.
Resumo:
Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).