980 resultados para RT-qPCR


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The inflammatory response elicited by various stimuli such as microbial products or cytokines is determined by differences in the pattern of cellular gene expression. We have used the differential display RT-PCR (DDRT-PCR) strategy to identify mRNAs that are differentially expressed in various murine cell types stimulated with pro-inflammatory cytokines, microbial products or anti-inflammatory drugs. Mouse embryonic fibroblasts (MEFs) were treated with IFNs, TNF, or sodium salicylate. Also, peritoneal macrophages from C3H/Hej mice were stimulated with T. cruzi-derived GPI-mucin and/or IFN-g. After DDRT-PCR, various cDNA fragments that were differentially represented on the sequencing gel were recovered, cloned and sequenced. Here, we describe a summary of several experiments and show that, when 16 of a total of 28 recovered fragments were tested for differential expression, 5 (31%) were found to represent mRNAs whose steady-state levels are indeed modulated by the original stimuli. Some of the identified cDNAs encode for known proteins that were not previously associated with the inflammatory process triggered by the original stimuli. Other cDNA fragments (8 of 21 sequences, or 38%) showed no significant homology with known sequences and represent new mouse genes whose characterization might contribute to our understanding of inflammation. In conclusion, DDRT-PCR has proven to be a potent technology that will allow us to identify genes that are differentially expressed when cells are subjected to changes in culture conditions or isolated from different organs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

IFN-gamma mRNA expression was evaluated in nonstimulated peripheral blood mononuclear cells (PBMC) of HIV-infected and seronegative individuals using quantitative competitive and semiquantitative RT-PCR and the sensitivity of these methods was compared. A significant correlation was found between quantitative competitive and semiquantitative RT-PCR in samples of both HIV-seronegative (P = 0.004) and HIV-infected individuals (P = 0.0004). PBMC from HIV-infected individuals presented a remarkable increase of IFN-gamma mRNA expression, as determined by both types of RT-PCR methods. Semiquantitative RT-PCR even without an internal standard is also acceptable for measuring cytokine mRNA expression, but less reliable if small amounts are quantified. Moreover, we found that increased IFN-gammamRNA expression is independent of CD4+ cell count in AIDS-free HIV-infected patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The reverse transcription-polymerase chain reaction (RT-PCR) is the most sensitive method used to evaluate gene expression. Although many advances have been made since quantitative RT-PCR was first described, few reports deal with the mathematical bases of this technique. The aim of the present study was to develop and standardize a competitive PCR method using standard-curves to quantify transcripts of the myogenic regulatory factors MyoD, Myf-5, Myogenin and MRF4 in chicken embryos. Competitor cDNA molecules were constructed for each gene under study using deletion primers, which were designed to maintain the anchorage sites for the primers used to amplify target cDNAs. Standard-curves were prepared by co-amplification of different amounts of target cDNA with a constant amount of competitor. The content of specific mRNAs in embryo cDNAs was determined after PCR with a known amount of competitor and comparison to standard-curves. Transcripts of the housekeeping ß-actin gene were measured to normalize the results. As predicted by the model, most of the standard-curves showed a slope close to 1, while intercepts varied depending on the relative efficiency of competitor amplification. The sensitivity of the RT-PCR method permitted the detection of as few as 60 MyoD/Myf-5 molecules per reaction but approximately 600 molecules of MRF4/Myogenin mRNAS were necessary to produce a measurable signal. A coefficient of variation of 6 to 19% was estimated for the different genes analyzed (6 to 9 repetitions). The competitive RT-PCR assay described here is sensitive, precise and allows quantification of up to 9 transcripts from a single cDNA sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tesis (Doctora en Ciencias con Especialidad en Biotecnología) U.A.N.L. Facultad de Ciencias Biológicas, 2007.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mémoire numérisé par la Division de la gestion de documents et des archives de l'Université de Montréal

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A dengue é a mais importante doença viral transmitida por mosquitos, no que diz respeito à morbidade e mortalidade, que afeta os seres humanos. Este vírus é transmitido pelos vetores Aedes albopictus e Aedes aegypti, este último é o principal vetor nas Américas. O controle da doença se baseia na vigilância laboratorial e vigilância entomológica. A vigilância laboratorial visa aprimorar a capacidade do diagnóstico, detectando precocemente a circulação viral e monitorando os sorotipos circulantes. Dentro deste tipo de vigilância, a RT-PCR é um método bastante usado no diagnóstico da doença em humanos e mosquitos, porém, a má conservação do material pode comprometer a integridade do RNA e trazer resultados falso-negativos. O desenvolvimento de melhores métodos de vigilância do vírus dengue (DENV) em mosquitos é de grande valor para os programas de controle. Desta maneira, o presente projeto visou otimizar a técnica de RT-PCR Multiplex para detecção de DENV em amostras de Ae. aegypti infectadas artificialmente pelo vírus. Primers que amplificam uma região de 80 pb do gene rpL8 de mosquito foram desenhados no site Primer3 e avaliados na ferramenta online Multiple Primer Analyzer, junto com primers que amplificam os sorotipos DENV. Não houve competição de primers e foi observado bandas distintas no gel de agarose. Foi avaliado o efeito de diferentes formas de preservação do material genético das amostras (RNAlater®, freezer -80°C e nitrogênio líquido) por 7 dias, onde não houve diferenças significativas em relação à integridade do RNA. O efeito de diferentes formas de extração de RNA (Kit da QIAGEN® , TRIzol® e Chomczymski-Sacchi) também foi avaliado e o método ChomczymskiSacchi obteve o melhor desempenho. A otimização desta técnica permitirá uma maior confiabilidade nos resultados, já que além da detecção dos sorotipos, haverá uma confirmação da qualidade do RNA, aprimorando a capacidade do diagnóstico e auxiliando a prevenção e controle da transmissão da dengue.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

P>To address whether seasonal variability exists among Shiga toxin-encoding bacteriophage (Stx phage) numbers on a cattle farm, conventional plaque assay was performed on water samples collected over a 17 month period. Distinct seasonal variation in bacteriophage numbers was evident, peaking between June and August. Removal of cattle from the pasture precipitated a reduction in bacteriophage numbers, and during the winter months, no bacteriophage infecting Escherichia coli were detected, a surprising occurrence considering that 1031 tailed-bacteriophages are estimated to populate the globe. To address this discrepancy a culture-independent method based on quantitative PCR was developed. Primers targeting the Q gene and stx genes were designed that accurately and discriminately quantified artificial mixed lambdoid bacteriophage populations. Application of these primer sets to water samples possessing no detectable phages by plaque assay, demonstrated that the number of lambdoid bacteriophage ranged from 4.7 x 104 to 6.5 x 106 ml-1, with one in 103 free lambdoid bacteriophages carrying a Shiga toxin operon (stx). Specific molecular biological tools and discriminatory gene targets have enabled virus populations in the natural environment to be enumerated and similar strategies could replace existing propagation-dependent techniques, which grossly underestimate the abundance of viral entities.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

TMV was tried to recover from a variety of branded cigarettes and cigars. Tobacco from six different brands of cigarettes and cigar were processed and reverse transcriptase polymerase chain reaction was employed for the detection of TMV. RTPCR confirmed the presence of TMV in tobacco from one brand of cigarette and one brand of cigar. Bean plants (Phaseolus vulgaris) were inoculated manually with tobacco sap of cigarettes resulting in the production of localized disease lesions. Together, these results showed that tobacco used to make cigarettes and cigars can function as an effective disease vector, potentially aiding the movement of infectious TMV between countries. This is an important finding prompting a need to test smoking tobacco for other virus particles that infect tobacco plants and survive processing as well as considering biosecurity measures to limit virus transmission

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The avian circadian system is composed of the retina, the mammalian homolog region of the suprachiasmatic nucleus (SNC), and the pineal gland. The retina, itself, displays many rhythmic physiological events, such as movements of photoreceptor cells, opsin expression, retinal reisomerization, and melatonin and dopamine production and secretion. Altogether, these rhythmic events are coordinated to predict environmental changes in light conditions during the day, optimizing retina function. The authors investigated the expression pattern of the melanopsin genes Opn4x and Opn4m, the clock genes Clock and Per2, and the genes for the key enzymes N-Acetyltransferase and Tyrosine Hidroxylase in chicken embryo dispersed retinal cells. Primary cultures of chicken retina from 8-day-old embryos were kept in constant dark (DD), in 12-h light/12-h dark (12L:12D), in 12L:12D followed by DD, or in DD in the absence or presence of 100 mu M glutamate for 12 h. Total RNA was extracted throughout a 24-h span, every 3 h starting at zeitgeber time 0 (ZT0) of the 6th day, and submitted to reverse transcriptase-polymerase chain reaction (RT-PCR) followed by quantitative PCR (qPCR) for mRNA quantification. The data showed no rhythmic pattern of transcription for any gene in cells kept in DD. However under a light-dark cycle, Clock, Per2, Opn4m, N-Acetyltransferase, and Tyrosine Hydroxylase exhibited rhythmic patterns of transcription. In DD, 100 mu M glutamate was able to induce rhythmic expression of Clock, strongly inhibited the expression of Tyrosine Hydroxylase, and, only at some ZTs, of Opn4x and Opn4m. The neurotransmitter had no effect on Per2 and N-Acetyltransferase transcription. The authors confirmed the expression of the protein OPN4x by immunocytochemistry. These results suggest that chicken embryonic retinal cells contain a functional circadian clock, whose synchronization requires light-dark cycle or glutamate stimuli. (Author correspondence: amdlcast@ib.usp.br).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is a standard assay in molecular medicine for gene expression analysis. Samples from incisional/needle biopsies, laser-microdissected tumor cells and other biologic sources, normally available in clinical cancer studies, generate very small amounts of RNA that are restrictive for expression analysis. As a consequence, an RNA amplification procedure is required to assess the gene expression levels of such sample types. The reproducibility and accuracy of relative gene expression data produced by sensitive methodology as qRT-PCR when cDNA converted from amplified (A) RNA is used as template has not yet been properly addressed. In this study, to properly evaluate this issue, we performed 1 round of linear RNA amplification in 2 breast cell lines (C5.2 and HB4a) and assessed the relative expression of 34 genes using cDNA converted from both nonamplified (NA) and A RNA. Relative gene expression was obtained from beta actin or glyceraldehyde 3-phosphate dehydrogenase normalized data using different dilutions of cDNA, wherein the variability and fold-change differences in the expression of the 2 methods were compared. Our data showed that 1 round of linear RNA amplification, even with suboptimal-quality RNA, is appropriate to generate reproducible and high-fidelity qRT-PCR relative expression data that have similar confidence levels as those from NA samples. The use of cDNA that is converted from both A and NA RNA in a single qRT-PCR experiment clearly creates bias in relative gene expression data.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Current knowledge of the pathogenic hantavirus indicates that wild rodents are its primary natural reservoir. Specific primers to detect the presence of viral genomes were developed using an SYBR-Green-based real-time RT-PCR protocol. One hundred sixty-four rodents native to the Atlantic Forest biome were captured in So Paulo State, Brazil, and their tissues were tested. The presence of hantavirus RNA was detected in sixteen rodents: three specimens of Akodon montensis, three of Akodon cursor, two of Necromys lasiurus, one of Juliomys sp., one of Thaptomys nigrita, five of Oligoryzomys nigripes, and one of Oryzomys sp. This SYBR Green real-time RT-PCR method for detection of hantavirus may be useful for surveying hantaviruses in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Arthropods display different mechanisms to protect themselves against infections, among which antimicrobial peptides (AMPs) play an important role, acting directly against invader pathogens. We have detected several factors with inhibitory activity against Candida albicans and Micrococcus luteus on the surface and in homogenate of eggs of the tick Rhipicephalus (Boophilus) microplus. One of the anti-M. luteus factors of the egg homogenate was isolated to homogeneity. Analysis by electrospray mass spectrometry (ESI-MS) revealed that it corresponds to microplusin, an AMP previously isolated from the cell-free hemolymph of X (B.) microplus. Reverse transcription (RT) quantitative polymerase chain reactions (qPCR) showed that the levels of microplusin mRNA gradually increase along ovary development, reaching an impressive highest value three days after the adult females have dropped from the calf and start oviposition. Interestingly, the level of microplusin mRNA is very low in recently laid eggs. An enhance of microplusin gene expression in eggs is observed only nine days after the onset of oviposition, achieving the highest level just before the larva hatching, when the level of expression decreases once again. Fluorescence microscopy analysis using an anti-microplusin serum revealed that microplusin is present among yolk granules of oocytes as well as in the connecting tube of ovaries. These results, together to our previous data. suggest that microplusin may be involved not only in protection of adult female hemocele, but also in protection of the female reproductive tract and embryos, what points this AMP as a considerable target for development of new methods to control R. (B.) microplus as well as the vector-borne pathogens. (c) 2009 Elsevier Ltd. All rights reserved.