937 resultados para Protein-interaction
Resumo:
The genomic era brought by recent advances in the next-generation sequencing technology makes the genome-wide scans of natural selection a reality. Currently, almost all the statistical tests and analytical methods for identifying genes under selection was performed on the individual gene basis. Although these methods have the power of identifying gene subject to strong selection, they have limited power in discovering genes targeted by moderate or weak selection forces, which are crucial for understanding the molecular mechanisms of complex phenotypes and diseases. Recent availability and rapid completeness of many gene network and protein-protein interaction databases accompanying the genomic era open the avenues of exploring the possibility of enhancing the power of discovering genes under natural selection. The aim of the thesis is to explore and develop normal mixture model based methods for leveraging gene network information to enhance the power of natural selection target gene discovery. The results show that the developed statistical method, which combines the posterior log odds of the standard normal mixture model and the Guilt-By-Association score of the gene network in a naïve Bayes framework, has the power to discover moderate/weak selection gene which bridges the genes under strong selection and it helps our understanding the biology under complex diseases and related natural selection phenotypes.^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
p53 is required for the maintenance of the genomic stability of cells. Mutations in the p53 tumor-suppressor gene occur in more than 50% of human cancers of diverse types. In addition, 70% of families with Li-Fraumeni syndrome have a germline mutation in p53, predisposing these individuals to multiple forms of cancer. In response to DNA damage, p53 becomes stabilized and activated. However the exact mechanism by which DNA damage signals the stabilization and activation of p53 still remains elusive. The biochemical activity of p53 that is required for tumor suppression, and presumably the cellular response to DNA damage, involves the ability of the protein to bind to specific DNA sequences and to function as a transcription factor. For the downstream targets, p53 transactivates many genes involved in growth arrest, apoptosis and DNA repair such as p21, Bax and GADD45, respectively. An open question in the field is how cells can determine the downstream effects of p53. ^ We hypothesize that, through its associated proteins, p53 can differentially transactivate its target genes, which determine its downstream effect. Additionally, p53 interacting proteins may be involved in signaling for the stabilization and activation of p53. Therefore, a key aspect to understanding p53 function is the identification and analysis of proteins that interact with it. We have employed the Sos recruitment system (SRS), a cytoplasmic yeast two-hybrid screen to identify p53 interacting proteins. The SRS is based on the ability of Sos to activate Ras when it becomes localized to the plasma membrane. The system takes advantage of an S. cerevisiae strain, cdc25-2 temperature sensitive mutant, harboring a mutation in Sos. In this strain, fusion proteins containing a truncated Sos will only localize to the membrane by protein-protein interaction, which allows growth at non-permissive temperature. This system allows the use of intact transcriptional activators such as p53. ^ To date, using a modified SRS library screen to identify p53 interacting proteins, I have identified p53 (known to interact with itself) and a novel p53-interacting protein (PIP). PIP is a specific p53 interacting protein in the SRS. The interaction of p53 and PIP was further confirmed by performing in vitro and in vivo binding assays. In the in vivo binding study, the interaction can only be detected in the presence of ionizing radiation suggesting that this interaction might be involved in DNA-damage induced p53-signalling pathway. After screening cDNA and genomic libraries, a full-length PIP-cDNA clone ( ∼ 3kb) was obtained which encodes a protein of 429 amino acids with calculated molecular weight of 46 kDa. The results of genebank search indicated that the PIP is an unidentified gene and contains a conserved ring-finger domain, which is present in a diverse family of regulatory proteins involved in different aspects of cellular function. Northern blot analysis revealed that the size of its messenge is approximately 3 kb preferentially expressed in brain, heart, liver and kidney. The PIP protein is mainly located in the cytoplasm as determined by the cellular localization of a green fluorescence fusion protein. Preliminary functional analysis revealed that PIP downregulated the transactivation activity of p53 on both p21 and mdm2 promoters. Thus, PIP may be a novel negative regulator of p53 subsequent to DNA damage. ^
Resumo:
Agrobacterium tumefaciens uses the VirB/D4 type IV secretion system (T4SS) to translocate oncogenic DNA (T-DNA) and protein substrates to plant cells. Independent of VirD4, the eleven VirB proteins are also essential for elaboration of a conjugative pilus termed the T pilus. The focus of this thesis is the characterization and analysis of two VirB proteins, VirB6 and VirB9, with respect to substrate translocation and T pilus biogenesis. Observed stabilizing effects of VirB6 on other VirB subunits and results of protein-protein interaction studies suggest that VirB6 mediates assembly of the secretion machine and T pilus through interactions with VirB7 and VirB9. Topology studies support a model for VirB6 as a polytopic membrane protein with a periplasmic N terminus, a large internal periplasmic loop, five transmembrane segments, and a cytoplasmic C terminus. Topology studies and Transfer DNA immunoprecipitation (TrIP) assays identified several important VirB6 functional domains: (i) the large internal periplasmic loop mediates interaction of VirB6 with the T-DNA, (ii) the membrane spanning region carboxyl-terminal to the large periplasmic loop mediates substrate transfer from VirB6 to VirB8, and (iii) the terminal regions of VirB6 are required for substrate transfer to VirB2 and VirB9. To analyze structure-function relationships of VirB9, the phenotypic consequences of dipeptide insertion mutations were characterized. Substrate discriminating mutations were shown to selectively export the oncogenic T-DNA and VirE2 to plant cells or a mobilizable IncQ plasmid to bacterial cells. Mutations affecting VirB9 interactions with VirB7 and VirB10 were localized to the C- and N- terminal regions respectively. Additionally, “uncoupling” mutations identified in VirB11 and VirB6 that block T pilus assembly, but not substrate transfer to recipient cells, were also identified in VirB9. These results in conjunction with computer analysis establish that VirB9, like VirB6, is also composed of distinct regions or domains that contribute in various ways to secretion channel activity and T pilus assembly. Lastly, in vivo immunofluorescent studies suggest that VirB9 localizes to the outer membrane and may play a role similar to that of secretion/ushers of types II and III secretion systems to facilitate substrate translocation across this final bacterial barrier. ^
Resumo:
Convincing evidence has accumulated to identify the Frizzled proteins as receptors for the Wnt growth factors. In parallel, a number of secreted frizzled-like proteins with a conserved N-terminal frizzled motif have been identified. One of these proteins, Frzb-1, binds Wnt-1 and Xwnt-8 proteins and antagonizes Xwnt-8 signaling in Xenopus embryos. Here we report that Frzb-1 blocks Wnt-1 induced cytosolic accumulation of β-catenin, a key component of the Wnt signaling pathway, in human embryonic kidney cells. Structure/function analysis reveals that complete removal of the frizzled domain of Frzb-1 abolishes the Wnt-1/Frzb-1 protein interaction and the inhibition of Wnt-1 mediated axis duplication in Xenopus embryos. In contrast, removal of the C-terminal portion of the molecule preserves both Frzb-Wnt binding and functional inhibition of Wnt signaling. Partial deletions of the Frzb-1 cysteine-rich domain maintain Wnt-1 interaction, but functional inhibition is lost. Taken together, these findings support the conclusion that the frizzled domain is necessary and sufficient for both activities. Interestingly, Frzb-1 does not block Wnt-5A signaling in a Xenopus functional assay, even though Wnt-5A coimmunoprecipitates with Frzb-1, suggesting that coimmunoprecipitation does not necessarily imply inhibition of Wnt function.
Resumo:
Fast neurotransmission requires that docked synaptic vesicles be located near the presynaptic N-type or P/Q-type calcium channels. Specific protein–protein interactions between a synaptic protein interaction (synprint) site on N-type and P/Q-type channels and the presynaptic SNARE proteins syntaxin, SNAP-25, and synaptotagmin are required for efficient, synchronous neurotransmitter release. Interaction of the synprint site of N-type calcium channels with syntaxin and SNAP-25 has a biphasic calcium dependence with maximal binding at 10–20 μM. We report here that the synprint sites of the BI and rbA isoforms of the α1A subunit of P/Q-type Ca2+ channels have different patterns of interactions with synaptic proteins. The BI isoform of α1A specifically interacts with syntaxin, SNAP-25, and synaptotagmin independent of Ca2+ concentration and binds with high affinity to the C2B domain of synaptotagmin but not the C2A domain. The rbA isoform of α1A interacts specifically with synaptotagmin and SNAP-25 but not with syntaxin. Binding of synaptotagmin to the rbA isoform of α1A is Ca2+-dependent, with maximum affinity at 10–20 μM Ca2+. Although the rbA isoform of α1A binds well to both the C2A and C2B domains of synaptotagmin, only the interaction with the C2A domain is Ca2+-dependent. These differential, Ca2+-dependent interactions of Ca2+ channel synprint sites with SNARE proteins may modulate the efficiency of transmitter release triggered by Ca2+ influx through these channels.
Resumo:
The yeast Saccharomyces cerevisiae contains two genes, PDE1 and PDE2, which respectively encode a low-affinity and a high-affinity cAMP phosphodiesterase. The physiological function of the low-affinity enzyme Pde1 is unclear. We show that deletion of PDE1, but not PDE2, results in a much higher cAMP accumulation upon addition of glucose or upon intracellular acidification. Overexpression of PDE1, but not PDE2, abolished the agonist-induced cAMP increases. These results indicate a specific role for Pde1 in controlling glucose and intracellular acidification-induced cAMP signaling. Elimination of a putative protein kinase A (PKA) phosphorylation site by mutagenesis of serine252 into alanine resulted in a Pde1ala252 allele that apparently had reduced activity in vivo. Its presence in a wild-type strain partially enhanced the agonist-induced cAMP increases compared with pde1Δ. The difference between the Pde1ala252 allele and wild-type Pde1 was strongly dependent on PKA activity. In a RAS2val19 pde2Δ background, the Pde1ala252 allele caused nearly the same hyperaccumulation of cAMP as pde1Δ, while its expression in a PKA-attenuated strain caused the same reduction in cAMP hyperaccumulation as wild-type Pde1. These results suggest that serine252 might be the first target site for feedback inhibition of cAMP accumulation by PKA. We show that Pde1 is rapidly phosphorylated in vivo upon addition of glucose to glycerol-grown cells, and this activation is absent in the Pde1ala252 mutant. Pde1 belongs to a separate class of phosphodiesterases and is the first member shown to be phosphorylated. However, in vitro the Pde1ala252 enzyme had the same catalytic activity as wild-type Pde1, both in crude extracts and after extensive purification. This indicates that the effects of the S252A mutation are not caused by simple inactivation of the enzyme. In vitro phosphorylation of Pde1 resulted in a modest and variable increase in activity, but only in crude extracts. This was absent in Pde1ala252, and phosphate incorporation was strongly reduced. Apparently, phosphorylation of Pde1 does not change its intrinsic activity or affinity for cAMP but appears to be important in vivo for protein-protein interaction or for targeting Pde1 to a specific subcellular location. The PKA recognition site is conserved in the corresponding region of the Schizosaccharomyces pombe and Candida albicans Pde1 homologues, possibly indicating a similar control by phosphorylation.
Resumo:
Eps15 is a substrate for the tyrosine kinase of the epidermal growth factor receptor (EGFR) and is characterized by the presence of a novel protein:protein interaction domain, the EH domain. Eps15 also stably binds the clathrin adaptor protein complex AP-2. Previous work demonstrated an essential role for eps15 in receptor-mediated endocytosis. In this study we show that, upon activation of the EGFR kinase, eps15 undergoes dramatic relocalization consisting of 1) initial relocalization to the plasma membrane and 2) subsequent colocalization with the EGFR in various intracellular compartments of the endocytic pathway, with the notable exclusion of coated vesicles. Relocalization of eps15 is independent of its binding to the EGFR or of binding of the receptor to AP-2. Furthermore, eps15 appears to undergo tyrosine phosphorylation both at the plasma membrane and in a nocodazole-sensitive compartment, suggesting sustained phosphorylation in endocytic compartments. Our results are consistent with a model in which eps15 undergoes cycles of association:dissociation with membranes and suggest multiple roles for this protein in the endocytic pathway.
Resumo:
The LMO2 gene is activated by chromosomal translocations in human T cell acute leukemias, but in mouse embryogenesis, Lmo2 is essential for initiation of yolk sac and definitive hematopoiesis. The LMO2 protein comprises two LIM–zinc-finger-like protein interaction modules and functions by interaction with specific partners in DNA-binding transcription complexes. We have now investigated the role of Lmo2-associated transcription complexes in the formation of the vascular system by following the fate of Lmo2-null embryonic stem (ES) cells in mouse chimeras. Lmo2 is expressed in vascular endothelium, and Lmo2-null ES cells contributed to the capillary network normally until around embryonic day 9. However, after this time, marked disorganization of the vascular system was observed in those chimeric mice that have a high contribution of Lmo2-null ES cells. Moreover, Lmo2-null ES cells do not contribute to endothelial cells of large vessel walls of surviving chimeric mice after embryonic day 10. These results show that Lmo2 is not needed for de novo capillary formation from mesoderm but is necessary for angiogenic remodeling of the existing capillary network into mature vasculature. Thus, Lmo2-mediated transcription complexes not only regulate distinct phases of hematopoiesis but also angiogenesis, presumably by Lmo2 interacting with distinct partners in the different settings.
A computationally directed screen identifying interacting coiled coils from Saccharomyces cerevisiae
Resumo:
Computational methods can frequently identify protein-interaction motifs in otherwise uncharacterized open reading frames. However, the identification of candidate ligands for these motifs (e.g., so that partnering can be determined experimentally in a directed manner) is often beyond the scope of current computational capabilities. One exception is provided by the coiled-coil interaction motif, which consists of two or more α helices that wrap around each other: the ligands for coiled-coil sequences are generally other coiled-coil sequences, thereby greatly simplifying the motif/ligand recognition problem. Here, we describe a two-step approach to identifying protein–protein interactions mediated by two-stranded coiled coils that occur in Saccharomyces cerevisiae. Coiled coils from the yeast genome are first predicted computationally, by using the multicoil program, and associations between coiled coils are then determined experimentally by using the yeast two-hybrid assay. We report 213 unique interactions between 162 putative coiled-coil sequences. We evaluate the resulting interactions, focusing on associations identified between components of the spindle pole body (the yeast centrosome).
Resumo:
Gephyrin is essential for both the postsynaptic localization of inhibitory neurotransmitter receptors in the central nervous system and the biosynthesis of the molybdenum cofactor (Moco) in different peripheral organs. Several alternatively spliced gephyrin transcripts have been identified in rat brain that differ in their 5′ coding regions. Here, we describe gephyrin splice variants that are differentially expressed in non-neuronal tissues and different regions of the adult mouse brain. Analysis of the murine gephyrin gene indicates a highly mosaic organization, with eight of its 29 exons corresponding to the alternatively spliced regions identified by cDNA sequencing. The N- and C-terminal domains of gephyrin encoded by exons 3–7 and 16–29, respectively, display sequence similarities to bacterial, invertebrate, and plant proteins involved in Moco biosynthesis, whereas the central exons 8, 13, and 14 encode motifs that may mediate oligomerization and tubulin binding. Our data are consistent with gephyrin having evolved from a Moco biosynthetic protein by insertion of protein interaction sequences.
Resumo:
Genes that are expressed only in the young zygote are considered to be of great importance in the development of an isogamous green alga, Chlamydomonas reinhardtii. Clones representing the Zys3 gene were isolated from a cDNA library prepared using zygotes at 10 min after fertilization. Sequencing of Zys3 cDNA clones resulted in the isolation of two related molecular species. One of them encoded a protein that contained two kinds of protein-to-protein interaction motifs known as ankyrin repeats and WW domains. The other clone lacked the ankyrin repeats but was otherwise identical. These mRNA species began to accumulate simultaneously in cells beginning 10 min after fertilization, and reached maximum levels at about 4 h, after which time levels decreased markedly. Genomic DNA gel-blot analysis indicated that Zys3 was a single-copy gene. The Zys3 proteins exhibited parallel expression to the Zys3 mRNAs at first, appearing 2 h after mating, and reached maximum levels at more than 6 h, but persisted to at least 1 d. Immunocytochemical analysis revealed their localization in the endoplasmic reticulum, which suggests a role in the morphological changes of the endoplasmic reticulum or in the synthesis and transport of proteins to the Golgi apparatus or related vesicles.
Resumo:
The plant-intracellular interaction of the avirulence protein AvrPto of Pseudomonas syringae pathovar tomato, the agent of bacterial speck disease, and the corresponding tomato resistance protein Pto triggers responses leading to disease resistance. Pto, a serine/threonine protein kinase, also interacts with a putative downstream kinase, Pto-interactor 1, as well as with members of a family of transcription factors Pto-interactors 4, 5, and 6. These proteins are likely involved, respectively, in a phosphorylation cascade resulting in hypersensitive cell death, and in defense gene activation. The mechanism by which the interaction of AvrPto and Pto initiates defense response signaling is not known. To pursue the hypothesis that tertiary interactions are involved, we modified the yeast two-hybrid protein interaction trap and conducted a search for tomato proteins that interact with Pto only in the presence of AvrPto. Five classes of AvrPto-dependent Pto interactors were isolated, and their interaction specificity confirmed. Also, to shed light on a recently demonstrated virulence activity of AvrPto, we conducted a standard two-hybrid screen for tomato proteins in addition to Pto that interact with AvrPto: i.e., potential virulence targets or modifiers of AvrPto. By constructing an N-terminal rather than a C-terminal fusion of AvrPto to the LexA DNA binding domain, we were able to overcome autoactivation by AvrPto and identify four classes of specific AvrPto-interacting proteins.
Modulation of the transcriptional activity of thyroid hormone receptors by the tumor suppressor p53.
Resumo:
Thyroid hormone nuclear receptors (TRs) are ligand-dependent transcriptional factors that regulate growth, differentiation, and development. The molecular mechanisms by which TRs mediate these effects are unclear. One prevailing hypothesis suggests that TRs may cooperate with other transcriptional factors to mediate their biological effects. In this study, we tested this hypothesis by examining whether the activity of TRs is modulated by the tumor suppressor p53. p53 is a nuclear protein that regulates gene expression via sequence-specific DNA binding and/or direct protein-protein interaction. We found that the human TR subtype beta 1 (h-TR beta 1) physically interacted with p53 via its DNA binding domain. As a result of this physical interaction, binding of h-TR beta 1 to its hormone response elements either as homodimer or as a heterodimer with the retinoic X receptor was inhibited by p53 in a concentration-dependent manner. In transfected cells, wild-type p53 repressed the hormone-dependent transcriptional activation of h-TR beta 1. In contrast, mutant p53 either had no effect or activated the transcriptional activity of h-TR beta 1 depending on the type of hormone response elements. These results indicate the gene regulating activity of TRs was modulated by p53, suggesting that the cross talk between these two transcriptional factors may play an important role in the biology of normal and cancer cells.
Resumo:
Transposon Tn1000 has been adapted to deliver novel DNA sequences for manipulating recombinant DNA. The transposition procedure for these "tagged" Tn1000s is simple and applicable to most plasmids in current use. For yeast molecular biology, tagged Tn1000s introduce a variety of yeast selective markers and replication origins into plasmids and cosmids. In addition, the beta-globin minimal promoter and lacZ gene of Tn(beta)lac serve as a mobile reporter of eukaryotic enhancer activity. In this paper, Tn(beta)lac was used to localize a mouse HoxB-complex enhancer in transgenic mice. Other tagged transposons create Gal4 DNA-binding-domain fusions, in either Escherichia coli or yeast plasmids, for use in one- and two-hybrid tests of transcriptional activation and protein-protein interaction, respectively. With such fusions, the Saccharomyces cerevisiae Swi6 G1/S-phase transcription factor and the Xenopus laevis Pintallavis developmental regulator are shown to activate transcription. Furthermore, the same transposon insertions also facilitated mapping of the Swi6 and Pintallavis domains responsible for transcriptional activation. Thus, as well as introducing novel sequences, tagged transposons share the numerous other applications of transposition such as producing insertional mutations, creating deletion series, or serving as mobile primer sites for DNA sequencing.