A study in the molecular and cellular functions of GSK3beta in prostate adenocarcinoma

Kinases are part of a complex network of signaling pathways that enable a cell to respond to changes in environmental conditions in a regulated and coordinated way. For example, Glycogen Synthase Kinase 3 beta (GSK3β) modulates conformational changes, protein-protein interaction, protein degradation, and activation of unique domains in proteins that transduce signals from the extracellular milieu to the nucleus. ^ In this project, I investigated the expression and function that GSK3β exhibits in prostate cells. The capacity of GSK3β to regulate two transcription factors (JUN and CREB), which are known to be inversely utilized in prostate tumor cells, was measured. JUN/AP1 is constitutively activated in PC-3 cells; whereas, CREB/CRE activity is ∼20 fold less than the former. GSK3β overexpression obliterates JUN/AP1 activity. With respect to CREB GSK3β increases CREB/CRE activity. Cellular levels of active GSK3β can determine whether JUN or CREB is preferentially active in the PC-3s. Theoretically, in response to a particular cellular context or stimulus, a cell may coordinate JUN and CREB function by regulating GSK3β.^ A comparison of various prostate cell lines showed that active GSK3β is less expressed in normal prostate epithelial cells than in tumor cells. Differentially expressed active (GSK3β) may correlate with progression of prostate carcinoma. If a known marker associated with carcinoma of the prostate could be shown to be regulated by GSK3β then, further study of GSK3β may lead to a better understanding of both possible prevention of the disease and improved therapy for advanced stages. ^ The androgen receptor (AR) is an intriguing phosphoprotein whose regulation is potentially determined by a variety of kinases. One of these is (GSK3β) I found that (GSK3β) is a regulator of the androgen receptor in both the unliganded and liganded states. It can inhibit AR function as measured by reporter assays. Also, GSK3β associates with the AR at the DNA binding domain because deletion constructs expressing either the n-terminus or the c-terminus (both having the DBD in common) immunoprecipitated with GSK3β. Increased understanding of how GSK3β functions in prostate cancer would provide clues into how (1) certain signal pathways are coordinated and (2) the androgen receptor may be regulated. ^

Novel molecular insights into human tooth agenesis

The development of dentition is a fascinating process that involves a complex series of epithelial-mesenchymel signaling interactions. That such a precise process frequently goes awry is not surprising. Indeed, tooth agenesis is one of the most commonly inherited disorders in humans that affects up to twenty percent of the population and imposes significant functional, emotional and financial burdens on patients. Mutations in the paired box domain containing transcription factor PAX9 result in autosomal dominant tooth agenesis that primarily involves posterior dentition. Despite these advances, little is known about how PAX9 mediates key signaling actions in tooth development and how aberrations in PAX9 functions lead to tooth agenesis. As an initial step towards providing evidence for the pathogenic role of mutant PAX9 proteins, I performed a series of molecular genetic analyses aimed at resolving the structural and functional defects produced by a number of PAX9 mutations causing non-syndromic posterior tooth agenesis. It is likely that the pathogenic mechanism underlying tooth agenesis for the first two mutations studied (219InsG and IIe87Phe) is haploinsufficiency. For the six paired domain missense mutations studied, the lack of functional defects observed for three of the mutant proteins suggests that these mutations altered PAX9 function through alternate mechanisms. Next, I explored further the nature of the partnership between Pax9 and the Msx1 homeoprotein and their role in the expression of a downstream effector molecule, Bmp4. When viewed in the context of events occurring in dental mesenchyme, the results of these studies indicate that the Pax9-Msx1 protein interaction involves the localized up-regulation of Bmp4 activity that is mediated by synergistic interactions between the two transcription factors. Importantly, these assays corroborate in vivo data from mouse genetic studies and support reports of Pax9-dependent expression of Bmp4 in dental mesenchyme. Taken together, these results suggest that PAX9 mutations cause an early developmental defect due to an inability to maintain the inductive potential of dental mesenchyme through involvement in a pathway involving Msx1 and Bmp4. ^

Identification of a conserved cluster in the RH domain of GRK critical for activation by GPCRs

One of the most critical aspects of G Protein Coupled Receptors (GPCRs) regulation is their rapid and acute desensitization following agonist stimulation. Phosphorylation of these receptors by GPCR kinases (GRK) is a major mechanism of desensitization. Considerable evidence from studies of rhodopsin kinase and GRK2 suggests there is an allosteric docking site for the receptor distinct from the GRK catalytic site. While the agonist-activated GPCR appears crucial for GRK activation, the molecular details of this interaction remain unclear. Recent studies suggested an important role for the N- and C-termini and domains in the small lobe of the kinase domain in allosteric activation; however, neither the mechanism of action of that site nor the RH domain contributions have been elucidated. To search for the allosteric site, we first indentified evolutionarily conserved sites within the RH and kinase domains presumably deterministic of protein function employing evolutionary trace (ET) methodology and crystal structures of GRK6. Focusing on a conserved cluster centered on helices 3, 9, and 10 in the RH domain, key residues of GRK5 and 6 were targeted for mutagenesis and functional assays. We found that a number of double mutations within helices 3, 9, and 10 and the N-terminus markedly reduced (50–90%) the constitutive phosphorylation of the β-2 Adrenergic Receptor (β2AR) in intact cells and phosphorylation of light-activated rhodopsin (Rho*) in vitro as compared to wild type (WT) GRK5 or 6. Based on these results, we designed peptide mimetics of GRK5 helix 9 both computationally and through chemical modifications with the goal of both confirming the importance of helix 9 and developing a useful inhibitor to disrupt the GPCR-GRK interaction. Several peptides were found to block Rho* phosphorylation by GRK5 including the native helix 9 sequence, Peptide Builder designed-peptide preserving only the key ET residues, and chemically locked helices. Most peptidomimetics showed inhibition of GRK5 activity greater than 80 % with an IC50 of ∼ 30 µM. Alanine scanning of helix 9 has further revealed both essential and non-essential residues for inhibition. Importantly, substitution of Arg 169 by an alanine in the native helix 9-based peptide gave an almost complete inhibition at 30 µM with an IC50 of ∼ 10 µM. In summary we report a previously unrecognized crucial role for the RH domain of GRK5 and 6, and the subsequent identification of a lead peptide inhibitor of protein-protein interaction with potential for specific blockade of GPCR desensitization. ^

Functional Characterization of AtxA, the Bacillus anthracis Virulence Regulator

Coordinated expression of virulence genes in Bacillus anthracis occurs via a multi-faceted signal transduction pathway that is dependent upon the AtxA protein. Intricate control of atxA gene transcription and AtxA protein function have become apparent from studies of AtxA-induced synthesis of the anthrax toxin proteins and the poly-D-glutamic acid capsule, two factors with important roles in B. anthracis pathogenesis. The amino-terminal region of the AtxA protein contains winged-helix (WH) and helix-turn-helix (HTH) motifs, structural features associated with DNA-binding. Using filter binding assays, I determined that AtxA interacted non-specifically at a low nanomolar affinity with a target promoter (Plef) and AtxA-independent promoters. AtxA also contains motifs associated with phosphoenolpyruvate: sugar phosphotransferase system (PTS) regulation. These PTS-regulated domains, PRD1 and PRD2, are within the central amino acid sequence. Specific histidines in the PRDs serve as sites of phosphorylation (H199 and H379). Phosphorylation of H199 increases AtxA activity; whereas, H379 phosphorylation decreases AtxA function. For my dissertation, I hypothesized that AtxA binds target promoters to activate transcription and that DNA-binding activity is regulated via structural changes within the PRDs and a carboxy-terminal EIIB-like motif that are induced by phosphorylation and ligand binding. I determined that AtxA has one large protease-inaccessible domain containing the PRDs and the carboxy-terminal end of the protein. These results suggest that AtxA has a domain that is distinct from the putative DNA-binding region of the protein. My data indicate that AtxA activity is associated with AtxA multimerization. Oligomeric AtxA was detected when co-affinity purification, non-denaturing gel electrophoresis, and bis(maleimido)hexane (BMH) cross-linking techniques were employed. I exploited the specificity of BMH for cysteine residues to show that AtxA was cross-linked at C402, implicating the carboxy-terminal EIIB-like region in protein-protein interactions. In addition, higher amounts of the cross-linked dimeric form of AtxA were observed when cells were cultured in conditions that promote toxin gene expression. Based on the results, I propose that AtxA multimerization requires the EIIB-like motif and multimerization of AtxA positively impacts function. I investigated the role of the PTS in the function of AtxA and the impact of phosphomimetic residues on AtxA multimerization. B. anthracis Enzyme I (EI) and HPr did not facilitate phosphorylation of AtxA in vitro. Moreover, markerless deletion of ptsHI in B. anthracis did not perturb AtxA function. Taken together, these results suggest that proteins other than the PTS phosphorylate AtxA. Point mutations mimicking phosphohistidine (H to D) and non-phosphorylated histidine (H to A) were tested for an impact on AtxA activity and multimerization. AtxA H199D, AtxA H199A, and AtxA H379A displayed multimerization phenotypes similar to that of the native protein, whereas AtxA H379D was not susceptible to BMH cross-linking or co-affinity purification with AtxA-His. These data suggest that phosphorylation of H379 may decrease AtxA activity by preventing AtxA multimerization. Overall, my data support the following model of AtxA function. AtxA binds to target gene promoters in an oligomeric state. AtxA activity is increased in response to the host-related signal bicarbonate/CO2 because this signal enhances AtxA multimerization. In contrast, AtxA activity is decreased by phosphorylation at H379 because multimerization is inhibited. Future studies will address the interplay between bicarbonate/CO2 signaling and phosphorylation on AtxA function.

Targeting TRAF6 for Cancer Therapeutical Development

Tumor necrosis factor (TNF)-Receptor Associated Factors (TRAFs) are a family of signal transducer proteins. TRAF6 is a unique member of this family in that it is involved in not only the TNF superfamily, but the toll-like receptor (TLR)/IL-1R (TIR) superfamily. The formation of the complex consisting of Receptor Activator of Nuclear Factor κ B (RANK), with its ligand (RANKL) results in the recruitment of TRAF6, which activates NF-κB, JNK and MAP kinase pathways. TRAF6 is critical in signaling with leading to release of various growth factors in bone, and promotes osteoclastogenesis. TRAF6 has also been implicated as an oncogene in lung cancer and as a target in multiple myeloma. In the hopes of developing small molecule inhibitors of the TRAF6-RANK interaction, multiple steps were carried out. Computational prediction of hot spot residues on the protein-protein interaction of TRAF6 and RANK were examined. Three methods were used: Robetta, KFC2, and HotPoint, each of which uses a different methodology to determine if a residue is a hot spot. These hot spot predictions were considered the basis for resolving the binding site for in silico high-throughput screening using GOLD and the MyriaScreen database of drug/lead-like compounds. Computationally intensive molecular dynamics simulations highlighted the binding mechanism and TRAF6 structural changes upon hit binding. Compounds identified as hits were verified using a GST-pull down assay, comparing inhibition to a RANK decoy peptide. Since many drugs fail due to lack of efficacy and toxicity, predictive models for the evaluation of the LD50 and bioavailability of our TRAF6 hits, and these models can be used towards other drugs and small molecule therapeutics as well. Datasets of compounds and their corresponding bioavailability and LD50 values were curated based, and QSAR models were built using molecular descriptors of these compounds using the k-nearest neighbor (k-NN) method, and quality of these models were cross-validated.

Network-based analysis of genome-wide scans of natural selection

The genomic era brought by recent advances in the next-generation sequencing technology makes the genome-wide scans of natural selection a reality. Currently, almost all the statistical tests and analytical methods for identifying genes under selection was performed on the individual gene basis. Although these methods have the power of identifying gene subject to strong selection, they have limited power in discovering genes targeted by moderate or weak selection forces, which are crucial for understanding the molecular mechanisms of complex phenotypes and diseases. Recent availability and rapid completeness of many gene network and protein-protein interaction databases accompanying the genomic era open the avenues of exploring the possibility of enhancing the power of discovering genes under natural selection. The aim of the thesis is to explore and develop normal mixture model based methods for leveraging gene network information to enhance the power of natural selection target gene discovery. The results show that the developed statistical method, which combines the posterior log odds of the standard normal mixture model and the Guilt-By-Association score of the gene network in a naïve Bayes framework, has the power to discover moderate/weak selection gene which bridges the genes under strong selection and it helps our understanding the biology under complex diseases and related natural selection phenotypes.^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

A novel DNA damage inducible inhibitor of p53

p53 is required for the maintenance of the genomic stability of cells. Mutations in the p53 tumor-suppressor gene occur in more than 50% of human cancers of diverse types. In addition, 70% of families with Li-Fraumeni syndrome have a germline mutation in p53, predisposing these individuals to multiple forms of cancer. In response to DNA damage, p53 becomes stabilized and activated. However the exact mechanism by which DNA damage signals the stabilization and activation of p53 still remains elusive. The biochemical activity of p53 that is required for tumor suppression, and presumably the cellular response to DNA damage, involves the ability of the protein to bind to specific DNA sequences and to function as a transcription factor. For the downstream targets, p53 transactivates many genes involved in growth arrest, apoptosis and DNA repair such as p21, Bax and GADD45, respectively. An open question in the field is how cells can determine the downstream effects of p53. ^ We hypothesize that, through its associated proteins, p53 can differentially transactivate its target genes, which determine its downstream effect. Additionally, p53 interacting proteins may be involved in signaling for the stabilization and activation of p53. Therefore, a key aspect to understanding p53 function is the identification and analysis of proteins that interact with it. We have employed the Sos recruitment system (SRS), a cytoplasmic yeast two-hybrid screen to identify p53 interacting proteins. The SRS is based on the ability of Sos to activate Ras when it becomes localized to the plasma membrane. The system takes advantage of an S. cerevisiae strain, cdc25-2 temperature sensitive mutant, harboring a mutation in Sos. In this strain, fusion proteins containing a truncated Sos will only localize to the membrane by protein-protein interaction, which allows growth at non-permissive temperature. This system allows the use of intact transcriptional activators such as p53. ^ To date, using a modified SRS library screen to identify p53 interacting proteins, I have identified p53 (known to interact with itself) and a novel p53-interacting protein (PIP). PIP is a specific p53 interacting protein in the SRS. The interaction of p53 and PIP was further confirmed by performing in vitro and in vivo binding assays. In the in vivo binding study, the interaction can only be detected in the presence of ionizing radiation suggesting that this interaction might be involved in DNA-damage induced p53-signalling pathway. After screening cDNA and genomic libraries, a full-length PIP-cDNA clone ( ∼ 3kb) was obtained which encodes a protein of 429 amino acids with calculated molecular weight of 46 kDa. The results of genebank search indicated that the PIP is an unidentified gene and contains a conserved ring-finger domain, which is present in a diverse family of regulatory proteins involved in different aspects of cellular function. Northern blot analysis revealed that the size of its messenge is approximately 3 kb preferentially expressed in brain, heart, liver and kidney. The PIP protein is mainly located in the cytoplasm as determined by the cellular localization of a green fluorescence fusion protein. Preliminary functional analysis revealed that PIP downregulated the transactivation activity of p53 on both p21 and mdm2 promoters. Thus, PIP may be a novel negative regulator of p53 subsequent to DNA damage. ^

Analysis of Agrobacterium tumefaciens VirB6 and VirB9 of the VirB /D4 type IV secretion system

Agrobacterium tumefaciens uses the VirB/D4 type IV secretion system (T4SS) to translocate oncogenic DNA (T-DNA) and protein substrates to plant cells. Independent of VirD4, the eleven VirB proteins are also essential for elaboration of a conjugative pilus termed the T pilus. The focus of this thesis is the characterization and analysis of two VirB proteins, VirB6 and VirB9, with respect to substrate translocation and T pilus biogenesis. Observed stabilizing effects of VirB6 on other VirB subunits and results of protein-protein interaction studies suggest that VirB6 mediates assembly of the secretion machine and T pilus through interactions with VirB7 and VirB9. Topology studies support a model for VirB6 as a polytopic membrane protein with a periplasmic N terminus, a large internal periplasmic loop, five transmembrane segments, and a cytoplasmic C terminus. Topology studies and Transfer DNA immunoprecipitation (TrIP) assays identified several important VirB6 functional domains: (i) the large internal periplasmic loop mediates interaction of VirB6 with the T-DNA, (ii) the membrane spanning region carboxyl-terminal to the large periplasmic loop mediates substrate transfer from VirB6 to VirB8, and (iii) the terminal regions of VirB6 are required for substrate transfer to VirB2 and VirB9. To analyze structure-function relationships of VirB9, the phenotypic consequences of dipeptide insertion mutations were characterized. Substrate discriminating mutations were shown to selectively export the oncogenic T-DNA and VirE2 to plant cells or a mobilizable IncQ plasmid to bacterial cells. Mutations affecting VirB9 interactions with VirB7 and VirB10 were localized to the C- and N- terminal regions respectively. Additionally, “uncoupling” mutations identified in VirB11 and VirB6 that block T pilus assembly, but not substrate transfer to recipient cells, were also identified in VirB9. These results in conjunction with computer analysis establish that VirB9, like VirB6, is also composed of distinct regions or domains that contribute in various ways to secretion channel activity and T pilus assembly. Lastly, in vivo immunofluorescent studies suggest that VirB9 localizes to the outer membrane and may play a role similar to that of secretion/ushers of types II and III secretion systems to facilitate substrate translocation across this final bacterial barrier. ^

The cysteine-rich frizzled domain of Frzb-1 is required and sufficient for modulation of Wnt signaling

Convincing evidence has accumulated to identify the Frizzled proteins as receptors for the Wnt growth factors. In parallel, a number of secreted frizzled-like proteins with a conserved N-terminal frizzled motif have been identified. One of these proteins, Frzb-1, binds Wnt-1 and Xwnt-8 proteins and antagonizes Xwnt-8 signaling in Xenopus embryos. Here we report that Frzb-1 blocks Wnt-1 induced cytosolic accumulation of β-catenin, a key component of the Wnt signaling pathway, in human embryonic kidney cells. Structure/function analysis reveals that complete removal of the frizzled domain of Frzb-1 abolishes the Wnt-1/Frzb-1 protein interaction and the inhibition of Wnt-1 mediated axis duplication in Xenopus embryos. In contrast, removal of the C-terminal portion of the molecule preserves both Frzb-Wnt binding and functional inhibition of Wnt signaling. Partial deletions of the Frzb-1 cysteine-rich domain maintain Wnt-1 interaction, but functional inhibition is lost. Taken together, these findings support the conclusion that the frizzled domain is necessary and sufficient for both activities. Interestingly, Frzb-1 does not block Wnt-5A signaling in a Xenopus functional assay, even though Wnt-5A coimmunoprecipitates with Frzb-1, suggesting that coimmunoprecipitation does not necessarily imply inhibition of Wnt function.

Ca2+-dependent and -independent interactions of the isoforms of the α1A subunit of brain Ca2+ channels with presynaptic SNARE proteins

Fast neurotransmission requires that docked synaptic vesicles be located near the presynaptic N-type or P/Q-type calcium channels. Specific protein–protein interactions between a synaptic protein interaction (synprint) site on N-type and P/Q-type channels and the presynaptic SNARE proteins syntaxin, SNAP-25, and synaptotagmin are required for efficient, synchronous neurotransmitter release. Interaction of the synprint site of N-type calcium channels with syntaxin and SNAP-25 has a biphasic calcium dependence with maximal binding at 10–20 μM. We report here that the synprint sites of the BI and rbA isoforms of the α1A subunit of P/Q-type Ca2+ channels have different patterns of interactions with synaptic proteins. The BI isoform of α1A specifically interacts with syntaxin, SNAP-25, and synaptotagmin independent of Ca2+ concentration and binds with high affinity to the C2B domain of synaptotagmin but not the C2A domain. The rbA isoform of α1A interacts specifically with synaptotagmin and SNAP-25 but not with syntaxin. Binding of synaptotagmin to the rbA isoform of α1A is Ca2+-dependent, with maximum affinity at 10–20 μM Ca2+. Although the rbA isoform of α1A binds well to both the C2A and C2B domains of synaptotagmin, only the interaction with the C2A domain is Ca2+-dependent. These differential, Ca2+-dependent interactions of Ca2+ channel synprint sites with SNARE proteins may modulate the efficiency of transmitter release triggered by Ca2+ influx through these channels.

The PDE1-encoded Low-Affinity Phosphodiesterase in the Yeast Saccharomyces cerevisiae Has a Specific Function in Controlling Agonist-induced cAMP Signaling

The yeast Saccharomyces cerevisiae contains two genes, PDE1 and PDE2, which respectively encode a low-affinity and a high-affinity cAMP phosphodiesterase. The physiological function of the low-affinity enzyme Pde1 is unclear. We show that deletion of PDE1, but not PDE2, results in a much higher cAMP accumulation upon addition of glucose or upon intracellular acidification. Overexpression of PDE1, but not PDE2, abolished the agonist-induced cAMP increases. These results indicate a specific role for Pde1 in controlling glucose and intracellular acidification-induced cAMP signaling. Elimination of a putative protein kinase A (PKA) phosphorylation site by mutagenesis of serine252 into alanine resulted in a Pde1ala252 allele that apparently had reduced activity in vivo. Its presence in a wild-type strain partially enhanced the agonist-induced cAMP increases compared with pde1Δ. The difference between the Pde1ala252 allele and wild-type Pde1 was strongly dependent on PKA activity. In a RAS2val19 pde2Δ background, the Pde1ala252 allele caused nearly the same hyperaccumulation of cAMP as pde1Δ, while its expression in a PKA-attenuated strain caused the same reduction in cAMP hyperaccumulation as wild-type Pde1. These results suggest that serine252 might be the first target site for feedback inhibition of cAMP accumulation by PKA. We show that Pde1 is rapidly phosphorylated in vivo upon addition of glucose to glycerol-grown cells, and this activation is absent in the Pde1ala252 mutant. Pde1 belongs to a separate class of phosphodiesterases and is the first member shown to be phosphorylated. However, in vitro the Pde1ala252 enzyme had the same catalytic activity as wild-type Pde1, both in crude extracts and after extensive purification. This indicates that the effects of the S252A mutation are not caused by simple inactivation of the enzyme. In vitro phosphorylation of Pde1 resulted in a modest and variable increase in activity, but only in crude extracts. This was absent in Pde1ala252, and phosphate incorporation was strongly reduced. Apparently, phosphorylation of Pde1 does not change its intrinsic activity or affinity for cAMP but appears to be important in vivo for protein-protein interaction or for targeting Pde1 to a specific subcellular location. The PKA recognition site is conserved in the corresponding region of the Schizosaccharomyces pombe and Candida albicans Pde1 homologues, possibly indicating a similar control by phosphorylation.

Eps15 Is Recruited to the Plasma Membrane upon Epidermal Growth Factor Receptor Activation and Localizes to Components of the Endocytic Pathway during Receptor Internalization

Eps15 is a substrate for the tyrosine kinase of the epidermal growth factor receptor (EGFR) and is characterized by the presence of a novel protein:protein interaction domain, the EH domain. Eps15 also stably binds the clathrin adaptor protein complex AP-2. Previous work demonstrated an essential role for eps15 in receptor-mediated endocytosis. In this study we show that, upon activation of the EGFR kinase, eps15 undergoes dramatic relocalization consisting of 1) initial relocalization to the plasma membrane and 2) subsequent colocalization with the EGFR in various intracellular compartments of the endocytic pathway, with the notable exclusion of coated vesicles. Relocalization of eps15 is independent of its binding to the EGFR or of binding of the receptor to AP-2. Furthermore, eps15 appears to undergo tyrosine phosphorylation both at the plasma membrane and in a nocodazole-sensitive compartment, suggesting sustained phosphorylation in endocytic compartments. Our results are consistent with a model in which eps15 undergoes cycles of association:dissociation with membranes and suggest multiple roles for this protein in the endocytic pathway.

The oncogenic LIM-only transcription factor Lmo2 regulates angiogenesis but not vasculogenesis in mice

The LMO2 gene is activated by chromosomal translocations in human T cell acute leukemias, but in mouse embryogenesis, Lmo2 is essential for initiation of yolk sac and definitive hematopoiesis. The LMO2 protein comprises two LIM–zinc-finger-like protein interaction modules and functions by interaction with specific partners in DNA-binding transcription complexes. We have now investigated the role of Lmo2-associated transcription complexes in the formation of the vascular system by following the fate of Lmo2-null embryonic stem (ES) cells in mouse chimeras. Lmo2 is expressed in vascular endothelium, and Lmo2-null ES cells contributed to the capillary network normally until around embryonic day 9. However, after this time, marked disorganization of the vascular system was observed in those chimeric mice that have a high contribution of Lmo2-null ES cells. Moreover, Lmo2-null ES cells do not contribute to endothelial cells of large vessel walls of surviving chimeric mice after embryonic day 10. These results show that Lmo2 is not needed for de novo capillary formation from mesoderm but is necessary for angiogenic remodeling of the existing capillary network into mature vasculature. Thus, Lmo2-mediated transcription complexes not only regulate distinct phases of hematopoiesis but also angiogenesis, presumably by Lmo2 interacting with distinct partners in the different settings.

A computationally directed screen identifying interacting coiled coils from Saccharomyces cerevisiae

Computational methods can frequently identify protein-interaction motifs in otherwise uncharacterized open reading frames. However, the identification of candidate ligands for these motifs (e.g., so that partnering can be determined experimentally in a directed manner) is often beyond the scope of current computational capabilities. One exception is provided by the coiled-coil interaction motif, which consists of two or more α helices that wrap around each other: the ligands for coiled-coil sequences are generally other coiled-coil sequences, thereby greatly simplifying the motif/ligand recognition problem. Here, we describe a two-step approach to identifying protein–protein interactions mediated by two-stranded coiled coils that occur in Saccharomyces cerevisiae. Coiled coils from the yeast genome are first predicted computationally, by using the multicoil program, and associations between coiled coils are then determined experimentally by using the yeast two-hybrid assay. We report 213 unique interactions between 162 putative coiled-coil sequences. We evaluate the resulting interactions, focusing on associations identified between components of the spindle pole body (the yeast centrosome).