Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Light- and cytokinin-induced changes in the levels of leucine and tyrosine isoaccepting tRNA species and modified nucleotide contents of total tRNA in cucumber seedlings

We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.

Complexity of collaborative work in residential aged care facilities: An analysis of information exchange for medication management

Information exchange (IE) is a critical component of the complex collaborative medication process in residential aged care facilities (RACFs). Designing information and communication technology (ICT) to support complex processes requires a profound understanding of the IE that underpins their execution. There is little existing research that investigates the complexity of IE in RACFs and its impact on ICT design. The aim of this study was thus to undertake an in-depth exploration of the IE process involved in medication management to identify its implications for the design of ICT. The study was undertaken at a large metropolitan facility in NSW, Australia. A total of three focus groups, eleven interviews and two observation sessions were conducted between July to August 2010. Process modelling was undertaken by translating the qualitative data via in-depth iterative inductive analysis. The findings highlight the complexity and collaborative nature of IE in RACF medication management. These models emphasize the need to: a) deal with temporal complexity; b) rely on an interdependent set of coordinative artefacts; and c) use synchronous communication channels for coordination. Taken together these are crucial aspects of the IE process in RACF medication management that need to be catered for when designing ICT in this critical area. This study provides important new evidence of the advantages of viewing process as a part of a system rather than as segregated tasks as a means of identifying the latent requirements for ICT design and that is able to support complex collaborative processes like medication management in RACFs. © 2012 IEEE.

Medication errors in residential aged care facilities: A distributed cognition analysis of the information exchange process

Background Medication safety is a pressing concern for residential aged care facilities (RACFs). Retrospective studies in RACF settings identify inadequate communication between RACFs, doctors, hospitals and community pharmacies as the major cause of medication errors. Existing literature offers limited insight about the gaps in the existing information exchange process that may lead to medication errors. The aim of this research was to explicate the cognitive distribution that underlies RACF medication ordering and delivery to identify gaps in medication-related information exchange which lead to medication errors in RACFs. Methods The study was undertaken in three RACFs in Sydney, Australia. Data were generated through ethnographic field work over a period of five months (May–September 2011). Triangulated analysis of data primarily focused on examining the transformation and exchange of information between different media across the process. Results The findings of this study highlight the extensive scope and intense nature of information exchange in RACF medication ordering and delivery. Rather than attributing error to individual care providers, the explication of distributed cognition processes enabled the identification of gaps in three information exchange dimensions which potentially contribute to the occurrence of medication errors namely: (1) design of medication charts which complicates order processing and record keeping (2) lack of coordination mechanisms between participants which results in misalignment of local practices (3) reliance on restricted communication bandwidth channels mainly telephone and fax which complicates the information processing requirements. The study demonstrates how the identification of these gaps enhances understanding of medication errors in RACFs. Conclusions Application of the theoretical lens of distributed cognition can assist in enhancing our understanding of medication errors in RACFs through identification of gaps in information exchange. Understanding the dynamics of the cognitive process can inform the design of interventions to manage errors and improve residents’ safety.

Metal-Nucleotide Interactions: Crystal Structures of Alkali (Li+, Na+, K+) and Alkaline Earth (Ca2+, Mg2+) Metal Complexes of Adenosine 2'-Monophosphate

Crystal structures of lithium, sodium, potassium, calcium and magnesium salts of adenosine 2'-monophosphate (2'-AMP) have been obtained at atomic resolution by X-ray crystallographic methods. 2'-AMP.Li belongs to the monoclinic space group P21 with a = 7.472(3)Å, b = 26.853(6) Å, c = 9.184(1)Å, b = 113.36(1)Å and Z= 4. 2'-AMP.Na and 2'-AMP.K crystallize in the trigonal space groups P31 and P3121 with a = 8.762(1)Å, c = 34.630(5)Å, Z= 6 and a = 8.931(4), Åc = 34.852(9)Å and Z= 6 respectively while 2'-AMP.Ca and 2'-AMP.Mg belong to space groups P6522 and P21 with cell parameters a = 9.487(2), c = 74.622(13), Z = 12 and a = 4.973(1), b = 10.023(2), c = 16.506(2), beta = 91.1(0) and Z = 2 respectively. All the structures were solved by direct methods and refined by full matrix least-squares to final R factors of 0.033, 0.028, 0.075, 0.069 and 0.030 for 2'-AMP.Li, 2'-AMP.Na, 2'- AMP.K, 2'-AMP.Ca and 2'-AMP.Mg, respectively. The neutral adenine bases in all the structures are in syn conformation stabilized by the O5'-N3 intramolecular hydrogen bond as in free acid and ammonium complex reported earlier. In striking contrast, the adenine base is in the anti geometry (cCN = -156.4(2)°) in 2'-AMP.Mg. Ribose moieties adopt C2'-endo puckering in 2'-AMP.Li and 2'-AMP.Ca, C2'-endo-C3'-exo twist puckering in 2'-AMP.Na and 2'-AMP.K and a C3'-endo-C2'-exo twist puckering in 2'-AMP.Mg structure. The conformation about the exocyclic C4'-C5' bond is the commonly observed gauche-gauche (g+) in all the structures except the gauche- trans (g-) conformation observed in 2'-AMP.Mg structure. Lithium ions coordinate with water, ribose and phosphate oxygens at distances 1.88 to 1.99Å. Na+ ions and K+ ions interact with phosphate and ribose oxygens directly and with N7 indirectly through a water oxygen. A distinct feature of 2'-AMP.Na and 2'-AMP.K structures is the involvement of ribose O4' in metal coordination. The calcium ion situated on a two-fold axis coordinates directly with three oxygens OW1, OW2 and O2 and their symmetry mates at distances 2.18 to 2.42Å forming an octahedron. A classic example of an exception to the existence of the O5'-N3 intramolecular hydorgen bond is the 2'-AMP.Mg strucure. Magnesium ion forms an octahedral coordination with three water and three phosphate oxygens at distances ranging from 2.02 to 2.11Å. A noteworthy feature of its coordination is the indirect link with N3 through OW3 oxygen resulting in macrochelation between the base and the phosphate group. Greater affnity of metal clays towards 5' compared to 2' and 3' nucleotides (J. Lawless, E. Edelson, and L. Manring, Am. Chem. Soc. Northwest Region Meeting, Seattle. 1978) due to macrochelation infered from solution studies (S. S. Massoud, H. Sigel, Eur. J. Biochem. 179, 451-458 (1989)) and interligand hydrogen bonding induced by metals postulated from metal-nucleotide structures in solid state (V. Swaminathan and M. Sundaralingam, CRC. Crit. Rev. Biochem. 6, 245-336 (1979)) are borne out by our structures also. The stacking patterns of adenine bases of both 2'-AMP.Na and 2'-AMP.K structures resemble the 2'-AMP.NH4 structure reported in the previous article. 2'-AMP.Li, 2'-AMP.Ca and 2'-AMP.Mg structures display base-ribose O4' stacking. An overview of interaction of monovalent and divalent cations with 2' and 5'-nucleotides has been presented.

Enhancement of (BH)(max) in a hard-soft-ferrite nanocomposite using exchange spring mechanism

We have observed the exchange spring behavior in the soft (Fe3O4)-hard (BaCa2Fe16O27)-ferrite composite by tailoring the particle size of the individual phases and by suitable thermal treatment of the composite. The magnetization curve for the nanocomposite heated at 800 degrees C shows a single loop hysteresis showing the existence of the exchange spring phenomena in the composite and an enhancement of 13% in (BH)(max) compared to the parent hard ferrite (BaCa2Fe16O27). The Henkel plot provides the proof of the presence of the exchange interaction between the soft and hard grains as well as its dominance over the dipolar interaction in the nanocomposite.

Ion exchange of sodium chloride and sodium bicarbonate solutions using strong acid cation resins in relation to coal seam water treatment

Coal seam gas production has resulted in the production of large volumes of associated water which contains dissolved salts dominated by sodium chloride and sodium bicarbonate. Ion exchange using synthetic resins has been proposed as a method for desalination of coal seam water to make it suitable for various beneficial reuse options. This study investigated the behaviour of solutions of sodium chloride and sodium bicarbonate with respect to exchange with Lanxess S108H strong acid cation (SAC) resin. Equilibrium isotherms were created for solutions of NaCl and NaHCO3 and an actual sample of coal seam water from the Surat Basin in southern Queensland. The exchange of sodium ions arising from sodium bicarbonate was found to be considerably more favourable than exchange of sodium ions from sodium chloride solutions. This latter behaviour was attributed to the secondary decomposition of bicarbonate species under acidic conditions which resulted in the evolution of carbon dioxide and formation of water. The isotherm profiles could not be satisfactorily fitted by a single isotherm model such as the Langmuir expression. Instead, two Langmuir equations had to be simultaneously applied in order to fit the sections of the isotherm attributable to sodium ion exchange from sodium bicarbonate and sodium chloride. The shape of the isotherm profile was dependent upon the ratio of sodium chloride to sodium bicarbonate in solution and there was a high degree of correlation between simulated and actual coal seam water solutions.

Relative stability of DNA as a generic criterion for promoter prediction: whole genome annotation of microbial genomes with varying nucleotide base composition

The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool `PromPredict'. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.

Nucleotide sequence and expression inE. coli of the complete P4 type VP4 from a G2 serotype human rotavirus

The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.

Cu-II-Azide Polymers of Cu-3 and Cu-6 Building Units: Synthesis,Structures, and Magnetic Exchange Mechanism

Two new neutral copper-azido polymers [Cu-3(N-3)(6)(tmen)(2)](n)(1)and [Cu-6(N-3)(12)(deen)(2)](n) (2) [tmen = N,N,N, N-tetramethylethylenediamine and deen = N,N-diethylethylenediamine] have been synthesized by using lower molar equivalents of the chelating diamine ligands with Cu(NO3)(2)center dot 3H(2)O and an excess of NaN3. The single crystal X-ray structure shows that in the basic unit of the 1D complex 1, the three Cu-II ions are linked by double end-on azido bridges with Cu-N-EO-Cu angles on both sides of the magnetic exchange critical angle of 108 degrees. Complex 2 is a 3D framework of a basic u-6 cluster. Cryomagnetic susceptibility measurements over a wide range of temperature exhibit dominant ferromagnetic behavior in both the complexes. Density functional theory calculations (B3LYP functional) have been performed on the trinuclear unit to provide a qualitative theoretical interpretation of the overall ferromagnetic behavior shown by the complex 1.

Mechanism of RNA Translocation by a Viral Packaging Motor

Molecular motors are proteins that convert chemical energy into mechanical work. The viral packaging ATPase P4 is a hexameric molecular motor that translocates RNA into preformed viral capsids. P4 belongs to the ubiquitous class of hexameric helicases. Although its structure is known, the mechanism of RNA translocation remains elusive. Here we present a detailed kinetic study of nucleotide binding, hydrolysis, and product release by P4. We propose a stochastic-sequential cooperative model to describe the coordination of ATP hydrolysis within the hexamer. In this model the apparent cooperativity is a result of hydrolysis stimulation by ATP and RNA binding to neighboring subunits rather than cooperative nucleotide binding. Simultaneous interaction of neighboring subunits with RNA makes the otherwise random hydrolysis sequential and processive. Further, we use hydrogen/deuterium exchange detected by high resolution mass spectrometry to visualize P4 conformational dynamics during the catalytic cycle. Concerted changes of exchange kinetics reveal a cooperative unit that dynamically links ATP binding sites and the central RNA binding channel. The cooperative unit is compatible with the structure-based model in which translocation is effected by conformational changes of a limited protein region. Deuterium labeling also discloses the transition state associated with RNA loading which proceeds via opening of the hexameric ring. Hydrogen/deuterium exchange is further used to delineate the interactions of the P4 hexamer with the viral procapsid. P4 associates with the procapsid via its C-terminal face. The interactions stabilize subunit interfaces within the hexamer. The conformation of the virus-bound hexamer is more stable than the hexamer in solution, which is prone to spontaneous ring openings. We propose that the stabilization within the viral capsid increases the packaging processivity and confers selectivity during RNA loading. Finally, we use single molecule techniques to characterize P4 translocation along RNA. While the P4 hexamer encloses RNA topologically within the central channel, it diffuses randomly along the RNA. In the presence of ATP, unidirectional net movement is discernible in addition to the stochastic motion. The diffusion is hindered by activation energy barriers that depend on the nucleotide binding state. The results suggest that P4 employs an electrostatic clutch instead of cycling through stable, discrete, RNA binding states during translocation. Conformational changes coupled to ATP hydrolysis modify the electrostatic potential inside the central channel, which in turn biases RNA motion in one direction. Implications of the P4 model for other hexameric molecular motors are discussed.

Association of the microRNA-Single Nucleotide Polymorphism rs2910164 in miR146a with sporadic breast cancer susceptibility: A case control study

Background Breast cancer (BC) is primarily considered a genetic disorder with a complex interplay of factors including age, gender, ethnicity, family history, personal history and lifestyle with associated hormonal and non-hormonal risk factors. The SNP rs2910164 in miR146a (a G to C polymorphism) was previously associated with increased risk of BC in cases with at least a single copy of the C allele in breast cancer, though results in other cancers and populations have shown significant variation. Methods In this study, we examined this SNP in an Australian sporadic breast cancer population of 160 cases and matched controls, with a replicate population of 403 breast cancer cases using High Resolution Melting. Results Our analysis indicated that the rs2910164 polymorphism is associated with breast cancer risk in both primary and replicate populations (p = 0.03 and 0.0013, respectively). In contrast to the results of familial breast cancer studies, however, we found that the presence of the G allele of rs2910164 is associated with increased cancer risk, with an OR of 1.77 (95% CI 1.40–2.23). Conclusions The microRNA miR146a has a potential role in the development of breast cancer and the effects of its SNPs require further inquiry to determine the nature of their influence on breast tissue and cancer.