Primary structure of hepatocyte nuclear factor/forkhead homologue 4 and characterization of gene expression in the developing respiratory and reproductive epithelium.

Members of the winged helix/forkhead family of transcription factors are believed to play a role in cell-specific gene expression. A cDNA encoding a member of this family of proteins, termed hepatocyte nuclear factor/forkhead homologue 4 (HFH-4), has been isolated from rat lung and rat testis cDNA libraries. This cDNA contains an open reading frame of 421 amino acids with a conserved DNA binding domain and several potential transactivating regions. During murine lung development, a single species of HFH-4-specific transcript (2.4 kb long) is first detected precisely at the start of the late pseudoglandular stage (embryonic day 14.5) and, by in situ hybridization, is specifically localized to the proximal pulmonary epithelium. The unique temporal and spatial pattern of HFH-4 gene expression in the developing lung defines this protein as a marker for the initiation of bronchial epithelial cell differentiation and suggests that it may play an important role in cell fate determination during lung development. In addition to expression in the pulmonary epithelium, RNA blot analysis reveals 2.4-kb HFH-4 transcripts in the testis and oviduct. By using mice with genetic defects in spermatogenesis, HFH-4 expression in the testis is found to be associated with the appearance of haploid germ cells and in situ hybridization studies indicate that HFH-4 expression is confined to stages I-VII of spermatogenesis. This pattern of HFH-4 gene expression during the early stages of differentiation of haploid germ cells suggests that HFH-4 may play a role in regulating stage-specific gene expression and cell-fate determination during lung development and in spermatogenesis.

Human von Willebrand factor gene sequences target expression to a subpopulation of endothelial cells in transgenic mice.

The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.

The ATX1 gene of Saccharomyces cerevisiae encodes a small metal homeostasis factor that protects cells against reactive oxygen toxicity.

In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as superoxide dismutase (SOD) and catalase. Here we describe the isolation and characterization of another gene in the yeast Saccharomyces cerevisiae that plays a critical role in detoxification of reactive oxygen species. This gene, named ATX1, was originally isolated by its ability to suppress oxygen toxicity in yeast lacking SOD. ATX1 encodes a 8.2-kDa polypeptide exhibiting significant similarity and identity to various bacterial metal transporters. Potential ATX1 homologues were also identified in multicellular eukaryotes, including the plants Arabidopsis thaliana and Oryza sativa and the nematode Caenorhabditis elegans. In yeast cells, ATX1 evidently acts in the transport and/or partitioning of copper, and this role in copper homeostasis appears to be directly relevant to the ATX1 suppression of oxygen toxicity: ATX1 was incapable of compensating for SOD when cells were depleted of exogenous copper. Strains containing a deletion in the chromosomal ATX1 locus were generated. Loss of ATX1 function rendered both mutant and wild-type SOD strains hypersensitive toward paraquat (a generator of superoxide anion) and was also associated with an increased sensitivity toward hydrogen peroxide. Hence, ATX1 protects cells against the toxicity of both superoxide anion and hydrogen peroxide.

Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF) 1 genes reveal evolutionary conservation in the IRF gene family.

Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.

The retinoblastoma-susceptibility gene product binds directly to the human TATA-binding protein-associated factor TAFII250.

RB, the protein product of the retinoblastoma tumor-suppressor gene, regulates the activity of specific transcription factors. This regulation appears to be mediated either directly through interactions with specific transcription factors or through an alternative mechanism. Here we report that stimulation of Sp1-mediated transcription by RB is partially abrogated at the nonpermissive temperature in ts13 cells. These cells contain a temperature-sensitive mutation in the TATA-binding protein-associated factor TAFII250, first identified as the cell cycle regulatory protein CCG1. The stimulation of Sp1-mediated transcription by RB in ts13 cells at the nonpermissive temperature could be restored by the introduction of wild-type human TAFII250. Furthermore, we demonstrate that RB binds directly to hTAFII250 in vitro and in vivo. These results suggest that RB can confer transcriptional regulation and possibly cell cycle control and tumor suppression through an interaction with TFIID, in particular with TAFII250.

Identification of the gene (SSU71/TFG1) encoding the largest subunit of transcription factor TFIIF as a suppressor of a TFIIB mutation in Saccharomyces cerevisiae.

Mutations in the Saccharomyces cerevisiae SSU71 gene were isolated as suppressors of a transcription factor TFIIB defect that confers both a cold-sensitive growth defect and a downstream shift in transcription start-site selection at the cyc1 locus. The ssu71-1 suppressor not only suppresses the conditional phenotype but also restores the normal pattern of transcription initiation at cyc1. In addition, the ssu71-1 suppressor confers a heat-sensitive phenotype that is dependent upon the presence of the defective form of TFIIB. Molecular and genetic analysis of the cloned SSU71 gene demonstrated that SSU71 is a single-copy essential gene encoding a highly charged protein with a molecular mass of 82,194 daltons. Comparison of the deduced Ssu71 amino acid sequence with the protein data banks revealed significant similarity to RAP74, the larger subunit of the human general transcription factor TFIIF. Moreover, Ssu71 is identical to p105, a component of yeast TFIIF. Taken together, these data demonstrate a functional interaction between TFIIB and the large subunit of TFIIF and that this interaction can affect start-site selection in vivo.

Induction of the gene encoding mucosal vascular addressin cell adhesion molecule 1 by tumor necrosis factor alpha is mediated by NF-kappa B proteins.

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Cardiotrophin-like cytokine/cytokine-like factor 1 is an essential trophic factor for lumbar and facial motoneurons in vivo

The ciliary neurotrophic factor alpha-receptor(CNTFRalpha) is required for motoneuron survival during development, but the relevant ligand(s) has not been determined. One candidate is the heterodimer formed by cardiotrophin-like cytokine (CLC) and cytokine-like factor 1 (CLF). CLC/CLF binds to CNTFRalpha and enhances the survival of developing motoneurons in vitro; whether this novel trophic factor plays a role in neural development in vivo has not been tested. We examined motor and sensory neurons in embryonic chicks treated with CLC and in mice with a targeted deletion of the clf gene. Treatment with CLC increased the number of lumbar spinal cord motoneurons that survived the cell death period in chicks. However, this effect was regionally specific, because brachial and thoracic motoneurons were unaffected. Similarly, newborn clf -/- mice exhibited a significant reduction in lumbar motoneurons, with no change in the brachial or thoracic cord. Clf deletion also affected brainstem motor nuclei in a regionally specific manner; the number of motoneurons in the facial but not hypoglossal nucleus was significantly reduced. Sensory neurons of the dorsal root ganglia were not affected by either CLC treatment or clf gene deletion. Finally, mRNA for both clc and clf was found in skeletal muscle fibers of embryonic mice during the motoneuron cell death period. These findings support the view that CLC/CLF is a target-derived factor required for the survival of specific pools of motoneurons. The in vivo actions of CLC and CLF can account for many of the effects of CNTFRalpha on developing motoneurons.

Epidermal Growth Factor Gene (EGF) Polymorphism and Risk of Melanocytic Neoplasiay

A common single nucleotide polymorphism (SNP) in the 5' untranslated region (5'UTR) of the epidermal growth factor (EGF) gene modulates the level of transcription of this gene and hence is associated with serum levels of EGF. This variant may be associated with melanoma risk, but conflicting findings have been reported. An Australian melanoma case-control sample was typed for the EGF+61A>G transversion (rs4444903). The sample comprised 753 melanoma cases from 738 families stratified by family history of melanoma and 2387 controls from 645 unselected twin families. Ancestry of the cases and controls was recorded, and the twins had undergone skin examination to assess total body nevus count, degree of freckling and pigmentation phenotype. SNP genotyping was carried out via primer extension followed by matrix-assisted laser desorption time of flight (MALDI-TOF) mass spectroscopy. The EGIF+61 SNP was not found to be significantly associated with melanoma status or with development of nevi or freckles. Among melanoma cases, however, G homozygotes had thicker tumors (p=0.05), in keeping with two previous studies. The EGF polymorphism does not appear to predispose to melanoma or nevus development, but its significant association with tumor thickness implies that it may be a useful marker of prognosis.

Investigation of the low-density lipoprotein receptor gene and cholesterol as a risk factor for migraine

The Low-Density Lipoprotein Receptor (LDLR) gene is a cell surface receptor that plays an important role in cholesterol homeostasis. We investigated the (TA)n polymorphism in exon 18 of the LDLR gene on chromosome 19p13.2 performing an association analysis in 244 typical migraine-affected patients, 151 suffering from migraine with aura (MA), 96 with migraine without aura (MO) and 244 unaffected controls. The populations consisted of Caucasians only, and controls were age- and sex-matched. The results showed no significant difference between groups for allele frequency distributions of the (TA)n polymorphism even after separation of the migraine-affected individuals into subgroups of MA and MO affected patients. This is in contradiction to Mochi et al. [Mochi M, Cevoli S, Cortelli P, Pierangeli G, Scapoli C, Soriani S, Montagna P. Investigation of an LDLR gene polymorphism (19p13.2) in susceptibility to migrane without aura. J Neurol Sci 2003; 213 (1-2): 7-10.] who found a positive association of this variant with MO. Our study discusses possible differences between the two studies and extends this research by investigating circulating cholesterol levels in a migraine-affected population. (C) 2004 Elsevier B.V. All rights reserved.

Origin and diversity of the Sox transcription factor gene family: genome-wide analysis in Fugu rubripes

The SOX family of transcription factors are found throughout the animal kingdom and are important in a variety of developmental contexts. Genome analysis has identified 20 Sox genes in human and mouse, which can be subdivided into 8 groups, based on sequence comparison and intron-exon structure. Most of the SOX groups identified in mammals are represented by a single SOX sequence in invertebrate model organisms, suggesting a duplication and divergence mechanism has operated during vertebrate evolution. We have now analysed the Sox gene complement in the pufferfish, Fugu rubripes, in order to shed further light on the diversity and origins of the Sox gene family. Major differences were found between the Sox family in Fugu and those in humans and mice. In particular, Fugu does not have orthologues of Sry, Sox,15 and Sox30, which appear to be specific to mammals, while Sox19, found in Fugu and zebrafish but absent in mammals, seems to be specific to fishes. Six mammalian Sox genes are represented by two copies each in Fugu, indicating a large-scale gene duplication in the fish lineage. These findings point to recent Sox gene loss, duplication and divergence occurring during the evolution of tetrapod and teleost lineages, and provide further evidence for large-scale segmental or a whole-genome duplication occurring early in the radiation of teleosts. (C) 2004 Elsevier B.V. All rights reserved.

HMG box transcription factor gene Hbp1 is expressed in germ cells of the developing mouse testis

HMG box containing protein 1 (HBP1) is a high mobility group domain transcriptional repressor that regulates proliferation in differentiated tissues. We have found mouse Hbp1 to be expressed strongly in the embryonic mouse testis from approximately 12.5 days post coitum, compared with low levels of expression in the embryonic ovary. Expression of Hbp1 is maintained in the developing testis beyond the onset of spermatogenesis after birth. Whole-mount in situ hybridisation analysis showed that expression of Hbp1 in the XY gonad is localized within the developing testis cords, the precursors of the seminiferous tubules. Expression of Hbp1 is not apparent in testis cords of gonads from homozygous We mutant embryos, which lack germ cells. In situ hybridisation analysis on cryosectioned embryonic testis indicated that Hbp1 expression resembles that of the germ cell marker Oct4. We conclude that Hbp1 is up-regulated specifically in germ cells of the developing XY gonad. The expression of Hbp1 in XY germ cells appears to correlate with the onset of mitotic arrest in these cells. (C) 2004 Wiley-Liss, Inc.

Repressor- and activator-type ethylene response factors functioning in jasmonate signaling and disease resistance identified via a genome-wide screen of Arabidopsis transcription factor gene expression

To identify transcription factors (TFs) involved in jasmonate (JA) signaling and plant defense, we screened 1,534 Arabidopsis (Arabidopsis thaliana) TFs by real-time quantitative reverse transcription-PCR for their altered transcript at 6 h following either methyl JA treatment or inoculation with the incompatible pathogen Alternaria brassicicola. We identified 134 TFs that showed a significant change in expression, including many APETALA2/ethylene response factor (AP2/ERF), MYB, WRKY, and NACTF genes with unknown functions. Twenty TF genes were induced by both the pathogen and methyl JA and these included 10 members of the AP2/ERF TF family, primarily from the B1a and B3 subclusters. Functional analysis of the B1a TF AtERF4 revealed that AtERF4 acts as a novel negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. In contrast, functional analysis of the B3 TF AtERF2 showed that AtERF2 is a positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. Our results suggest that plants coordinately express multiple repressor-and activator-type AP2/ERFs during pathogen challenge to modulate defense gene expression and disease resistance.

Distinct roles for interleukin-12p40 and tumour necrosis factor in resistance to oral candidiasis defined by gene-targeting

Cell-mediated immunity is important for anti-Candida host defence in mucosal tissues. In this study we used cytokine-specific gene knockout mice to investigate the requirement for T helper type 1 (Th1) and Th2 cytokines in recovery from oral candidiasis. Knockout mice used in this study included interleukin-4 (IL-4), IL-10, IL-12p40, interferon-gamma (IFN-gamma), and tumour necrosis factor (TNF). The mice were challenged either orally or systemically with Candida albicans yeasts, and levels of colonization were determined. IL-12p40 knockout mice developed chronic oropharyngeal candidiasis, but were not more susceptible to systemic challenge. On the other hand, TNF knockout mice displayed increased susceptibility to both oral and systemic challenge, but only in the acute stages of infection. TNF apparently has a protective effect in the acute stages of both oral and systemic candidiasis, whereas IL-12p40 is essential for recovery from oral but not systemic candidiasis. The role of IL-12p40, and its relation to T-cell-mediated responses remain to be determined.