958 resultados para Negative ion formation


Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND Eosinophilic esophagitis (EoE) exhibits esophageal dysfunction owing to an eosinophil-predominant inflammation. Activated eosinophils generate eosinophil extracellular traps (EETs) able to kill bacteria. There is evidence of an impaired barrier function in EoE that might allow pathogens to invade the esophagus. This study aimed to investigate the presence and distribution of EETs in esophageal tissues from EoE patients and their association with possible epithelial barrier defects. METHODS Anonymized tissue samples from 18 patients with active EoE were analyzed. The presence of DNA nets associated with eosinophil granule proteins forming EETs and the expression of filaggrin, the protease inhibitor lympho-epithelial Kazal-type-related inhibitor (LEKTI), antimicrobial peptides, and cytokines were evaluated by confocal microscopy following immune fluorescence staining techniques. RESULTS Eosinophil extracellular trap formation occurred frequently and was detected in all EoE samples correlating with the numbers of infiltrating eosinophils. While the expression of both filaggrin and LEKTI was reduced, epithelial antimicrobial peptides (human beta-defensin-2, human beta-defensin-3, cathelicidin LL-37, psoriasin) and cytokines (TSLP, IL-25, IL-32, IL-33) were elevated in EoE as compared to normal esophageal tissues. There was a significant correlation between EET formation and TSLP expression (P = 0.02) as well as psoriasin expression (P = 0.016). On the other hand, a significant negative correlation was found between EET formation and LEKTI expression (P = 0.016). CONCLUSION Active EoE exhibits the presence of EETs. Indications of epithelial barrier defects in association with epithelial cytokines are also present which may have contributed to the activation of eosinophils. The formation of EETs could serve as a firewall against the invasion of pathogens.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Molecular nitrogen (N2) is thought to have been the most abundant form of nitrogen in the protosolar nebula. It is the main N-bearing molecule in the atmospheres of Pluto and Triton and probably the main nitrogen reservoir from which the giant planets formed. Yet in comets, often considered the most primitive bodies in the solar system, N2 has not been detected. Here we report the direct in situ measurement of N2 in the Jupiter family comet 67P/Churyumov-Gerasimenko, made by the Rosetta Orbiter Spectrometer for Ion and Neutral Analysis mass spectrometer aboard the Rosetta spacecraft. A N2/CO ratio of Embedded Image (2σ standard deviation of the sampled mean) corresponds to depletion by a factor of ~25.4 ± 8.9 as compared to the protosolar value. This depletion suggests that cometary grains formed at low-temperature conditions below ~30 kelvin.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

High-energy e(-) and pi(-) were measured by the multichannel plate (MCP) detector at the PiM1 beam line of the High Intensity Proton Accelerator Facilities located at the Paul Scherrer Institute, Villigen, Switzerland. The measurements provide the absolute detection efficiencies for these particles: 5.8% +/- 0.5% for electrons in the beam momenta range 17.5-300 MeV/c and 6.0% +/- 1.3% for pions in the beam momenta range 172-345 MeV/c. The pulse height distribution determined from the measurements is close to an exponential function with negative exponent, indicating that the particles penetrated the MCP material before producing the signal somewhere inside the channel. Low charge extraction and nominal gains of the MCP detector observed in this study are consistent with the proposed mechanism of the signal formation by penetrating radiation. A very similar MCP ion detector will be used in the Neutral Ion Mass (NIM) spectrometer designed for the JUICE mission of European Space Agency (ESA) to the Jupiter system, to perform measurements of the chemical composition of the Galilean moon exospheres. The detection efficiency for penetrating radiation determined in the present studies is important for the optimisation of the radiation shielding of the NIM detector against the high-rate and high-energy electrons trapped in Jupiter's magnetic field. Furthermore, the current studies indicate that MCP detectors can be useful to measure high-energy particle beams at high temporal resolution. (C) 2015 AIP Publishing LLC.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Friedreich's ataxia is caused by the expansion of the GAA•TTC trinucleotide repeat sequence located in intron 1 of the frataxin gene. The long GAA•TTC repeats are known to form several non-B DNA structures including hairpins, triplexes, parallel DNA and sticky DNA. Therefore it is believed that alternative DNA structures play a role in the loss of mRNA transcript and functional frataxin protein in FRDA patients. We wanted to further elucidate the characteristics for formation and stability of sticky DNA by evaluating the structure in a plasmid based system in vitro and in vivo in Escherichia coli. The negative supercoil density of plasmids harboring different lengths of GAA•TTC repeats, as well as either one or two repeat tracts were studied in E. coli to determine if plasmids containing two long tracts (≥60 repeats) in a direct repeat orientation would have a different topological effect in vivo compared to plasmids that harbored only one GAA•TTC tract or two tracts of < 60 repeats. The experiments revealed that, in fact, sticky DNA forming plasmids had a lower average negative supercoil density (-σ) compared to all other control plasmids used that had the potential to form other non-B DNA structures such as triplexes or Z-DNA. Also, the requirements for in vitro dissociation and reconstitution of the DNA•DNA associated region of sticky DNA were evaluated. Results conclude that the two repeat tracts associate in the presence of negative supercoiling and MgCl 2 or MnCl2 in a time and concentration-dependent manner. Interaction of the repeat sequences was not observed in the absence of negative supercoiling and/or MgCl2 or in the presence of other monovalent or divalent cations, indicating that supercoiling and quite specific cations are needed for the association of sticky DNA. These are the first experiments studying a more specific role of supercoiling and cation influence on this DNA conformation. To support our model of the topological effects of sticky DNA in plasmids, changes in sticky DNA band migration was measured with reference to the linear DNA after treatment with increasing concentrations of ethidium bromide (EtBr). The presence of independent negative supercoil domains was confirmed by this method and found to be segregated by the DNA-DNA associated region. Sequence-specific polyamide molecules were used to test the effect of binding of the ligands to the GAA•TTC repeats on the inhibition of sticky DNA. The destabilization of the sticky DNA conformation in vitro through this binding of the polyamides demonstrated the first conceptual therapeutic approach for the treatment of FRDA at the DNA molecular level. ^ Thus, examining the properties of sticky DNA formed by these long repeat tracts is important in the elucidation of the possible role of sticky DNA in Friedreich's ataxia. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Drosophila Transformer-2 (Tra2) protein activates the splicing of doublesex and fruitless pre-mRNA and represses M1 intron splicing in its own RNA in male germline. The M1 retention is part of negative feedback mechanism that controls Tra2 protein synthesis. However it is not known how the M1 intron is repressed or why Tra2 activates splicing of some RNAs while repressing splicing in others. Here we show that Tra2 and SR protein Rbp1 function together to specifically repress M1 splicing in vitro through the same intronic silencer by binding independently to distinct sites. The role of Rbp1 in M1 repression in vivo was validated by the finding that increased expression of Rbp1 in S2 cells promotes M1 retention. Furthermore, Tra2 blocks prespliceosomal A complex formation, a step corresponding to U2 snRNP recruitment to the branchpoint. High levels of Tra2 repression require an upstream enhancer. Together, we propose that the complex formed by Tra2 and Rbp1 on the silencer achieves splicing repression by blocking the recognition of the branchpoint or antagonizing enhancer function. ^ In addition, both splicing regulatory activities of Tra2 are essential developmental events, doublesex splicing is the key for Drosophila sex determination in the soma, while M1 retention occurs in the male germline and is necessary for spermatogenesis. However, active Tra2 is expressed ubiquitously. So another issue we have studied is how Tra2 accomplishes negative and positive splicing regulation in a tissue-specific fashion. Surprisingly, we found that nuclear extract from somatically-derived S2 cells support M1 repression in vitro. This led us to hypothesize that no germline specific factor is required and that high levels of Tra2 expression in the male germline is sufficient to trigger M1 retention. To test it, I examined whether increased expression of Tra2 could promote M1 retention in cells outside male germline. My results show that increased Tra2 expression promotes M1 retention in somatically-derived S2 cells as well as in the somatic tissues of living flies. These results show that somatic tissues are capable of supporting M1 repression but do not normally do so because the low levels of Tra2 do not trigger negative feedback regulation. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Processes governing the formation of rare earth element (REE) composition are under consideration for ferromanganese deposits (nodules, separate parts of nodules, and micronodules of different size fractions) within the Clarion-Clipperton ore province in the Pacific Ocean. It is shown that ferromanganese oxyhydroxide deposits with different chemical compositions can be produced in sediments under similar sedimentation conditions. In areas with high bioproductivity size of micronodules has positive correlation with Mn content and Mn/Fe and P/Fe ratios and negative correlation with Fe, P, REE, and Ce anomaly. Behavior of REE in micronodules from sediments within bioproductive zones is related to increase of influence of diagenetic processes in sediments as a response to the growth of size of micronodules. Distinctions in chemical composition of micronodules and nodules are related to their interaction with associated sediments. Micronodules grow in sediments using hydrogenous ferromanganese oxyhydroxides. As they grow, micronodules are enriched in labile fraction of sediments reworked during diagenesis. Sources of material of ferromanganese nodules are governed by their formation at the water bottom interface. Their upper part is formed by direct settling of iron oxyhydroxides from bottom water, whereas the lower part is accumulated due to diagenetic processes in sediments. Differences of REE compositions in ferromanganese deposits are caused by the reduction of manganese during diagenesis and its separation from iron. Iron oxyhydroxides form a sorption complex due to sorption of phosphate-ion from bottom and pore waters. Sorption of phosphate-ion results in additional sorption of REE.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Jinshajiang suture zone, located in the eastern part of the Tethyan tectonic domain, is noticeable for a large-scale distribution of Late Jurassic to Triassic granitoids. These granitoids were genetically related to the evolution of the Paleo-Tethys Ocean. The Beiwu, Linong and Lunong granitoids occur in the middle zone of the Jinshajiang Suture Zone, and possess similar geochemical features, indicating they share a common magma source. SIMS zircon U-Pb dating reveals the Beiwu, Linong and Lunong granitic intrusions were emplaced at 233.9±1.4 Ma (2 sigma), 233.1 ±1.4 Ma (2 sigma) and 231.0±1.6 Ma (2 sigma), respectively. All of these granitoids are enriched in abundances of Si (SiO2 =65.2-73.5 wt.%), and large-ion-lithophile-elements (LILEs), but depleted in high-field-strength-elements contents (HFSEs, e.g., Nb, Ta, Ti). In addition, they have low P2O5 contents (0.06-0.11 wt.%), A/CNK values ([molecular Al2O3/(CaO+Na2O+K2O)], mostly<1.1) and 10000Ga/Al ratios (1.7-2.2), consistent with the characteristics of I-type granites. In terms of isotopic compositions, these granitoids have high initial 87Sr/86Sr ratios (0.7078-0.7148), Pb isotopic compositions [(206Pb/204Pb)t=18.213-18.598, (207Pb/204Pb)t=15.637-15.730 and (208Pb/204Pb)t=38.323-38.791], zircon d18O values (7. per mil-9.3 per mil) and negative eNd(t) values (-5.1 to -6.7), suggesting they were predominantly derived from the continental crust. Their Nb/Ta ratios (average value=8.6) are consistent with those of the lower continental crust (LCC). However, variable ?Hf(t) values (-8.6 to +2.8) and the occurrences of mafic microgranular enclaves (MMEs) suggest that mantle-derived melts and lower crustal magmas were involved in the generation of these granitoids. Moreover, the high Pb isotopic ratios and elevated zircon d18O values of these rocks indicate a significant contribution of the upper crustal composition. We propose a model in which the Beiwu, Linong and Lunong granitoids were generated under a late collisional or post-collisional setting. It is possible that this collision was completed before Late Triassic. Decompression induced mantle-derived magmas underplated and provided the heat for the anatexis of the crust. Hybrid melts including mantle-derived and the lower crustal magmas were then generated. The hybrid melts thereafter ascended to a shallow depth and resulted in some degree of sedimentary rocks assimilation. Such three-component mixing magmas source and subsequent fractional crystallization could be responsible for the formation of the Beiwu, Linong and Lunong granitoids.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

New petrological and geochemical data were obtained for basalts recovered during cruise 24 of the R/V "Akademik Nikolay Strakhov" in 2006. These results significantly contributed to the understanding of the formation of tholeiitic magmatism at the northern end of the Knipovich Ridge of the Polar Atlantic. Dredging was performed for the first time both in the rift valley and on the flanks of the ridge. It showed that the conditions of magmatism have not changed since at least 10 Ma. The basalts correspond to slightly enriched tholeiites, whose primary melts were derived at the shallowest levels and were enriched in Na and depleted in Fe (Na-TOR type). The most enriched basalts are typical of the earlier stages of the opening and were found on the flanks of the ridge in its northernmost part. Variations in the ratios of Sr, Nd, and Pb isotopes and lithophile elements allowed us to conclude that the primary melts generated beneath the spreading zone of the Knipovich Ridge were modified by the addition of the enriched component that was present both in the Neogene and Quaternary basalts of Spitsbergen Island. Compared with the primitive mantle, the extruding magmas were characterized by positive Nb and Zr anomalies and a negative Th anomaly. The formation of primary melts involved melting of the metasomatized depleted mantle reservoir that appeared during the early stages of opening of the Norwegian-Greenland Basin and transformation of the paleo-Spitsbergen Fault into the Knipovich spreading ridge, which was accompanied by magmatism in western Spitsbergen during its separation from the northern part of Greenland.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Duolong porphyry Cu-Au deposit (5.4 Mt at 0.72% Cu, 41 t at 0.23 g/t Au), which is related to the granodiorite porphyry and the quartz-diorite porphyry from the Bangongco copper belt in central Tibet, formed in a continental arc setting. Here, we present the zircon U-Pb ages, geochemical whole-rock, Sr-Nd whole-rock and zircon in-situ Hf-O isotopic data for the Duolong porphyries. Secondary ion mass spectrometry (SIMS) zircon U-Pb analyses for six samples yielded consistent ages of ~118 Ma, indicating a Cretaceous formation age. The Duolong porphyries (SiO2 of 58.81-68.81 wt.%, K2O of 2.90-5.17 wt.%) belong to the high-K calc-alkaline series. They show light rare earth element (LREE)-enriched distribution patterns with (La/Yb)N = 6.1-11.7, enrichment in large ion lithophile elements (e.g., Cs, Rb, and Ba) and depletion of high field strength elements (e.g., Nb), with negative Ti anomalies. All zircons from the Duolong porphyries share relatively similar Hf-O isotopic compositions (d18O=5.88-7.27 per mil; eHf(t)=3.6-7.3), indicating that they crystallized from a series of cogenetic melts with various degrees of fractional crystallization. This, along with the general absence of older inherited zircons, rules out significant crustal contamination during zircon growth. The zircons are mostly enriched in d18O relative to mantle values, indicating the involvement of an 18O-enriched crustal source in the generation of the Duolong porphyries. Together with the presence of syn-mineralization basaltic andesite, the mixing between silicic melts derived from the lower crust and evolved H2O-rich mafic melts derived from the metsomatizied mantle wedge, followed by subsequent fractional crystallization (FC) and minor crustal contamination in the shallow crust, could well explain the petrogenesis of the Duolong porphyries. Significantly, the hybrid melts possibly inherited the arc magma characteristics of abundant F, Cl, Cu, and Au elements and high oxidation state, which contributed to the formation of the Duolong porphyry Cu-Au deposit.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coral reef organisms are increasingly and simultaneously affected by global and local stressors such as ocean acidification (OA) and reduced light availability. However, knowledge of the interplay between OA and light availability is scarce. We exposed 2 calcifying coral reef species (the scleractinian coral Acropora millepora and the green alga Halimeda opuntia) to combinations of ambient and increased pCO2 (427 and 1073 µatm, respectively), and 2 light intensities (35 and 150 µmol photons/m**2/s) for 16 d. We evaluated the individual and combined effects of these 2 stressors on weight increase, calcification rates, O2 fluxes and chlorophyll a content for the species investigated. Weight increase of A. millepora was significantly reduced by OA (48%) and low light intensity (96%) compared to controls. While OA did not affect coral calcification in the light, it decreased calcification in the dark by 155%, leading to dissolution of the skeleton. H. opuntia weight increase was not affected by OA, but decreased (40%) at low light. OA did not affect algae calcification in the light, but decreased calcification in the dark by 164%, leading to dissolution. Low light significantly reduced gross photosynthesis (56 and 57%), net photosynthesis (62 and 60%) and respiration (43 and 48%) of A. millepora and H. opuntia, respectively. In contrast to A. millepora, H. opuntia significantly increased chlorophyll content by 15% over the course of the experiment. No interactive effects of OA and low light intensity were found on any response variable for either organism. However, A. millepora exhibited additive effects of OA and low light, while H. opuntia was only affected by low light. Thus, this study suggests that negative effects of low light and OA are additive on corals, which may have implications for management of river discharge into coastal coral reefs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A large percentage of CO2 emitted into the atmosphere is absorbed by the oceans, causing chemical changes in surface waters known as ocean acidification (OA). Despite the high interest and increased pace of OA research to understand the effects of OA on marine organisms, many ecologically important organisms remain unstudied. Calcidiscus is a heavily calcified coccolithophore genus that is widespread and genetically and morphologically diverse. It contributes substantially to global calcium carbonate production, organic carbon production, oceanic carbon burial, and ocean-atmosphere CO2 exchange. Despite the importance of this genus, relatively little work has examined its responses to OA. We examined changes in growth, morphology, and carbon allocation in multiple strains of Calcidiscus leptoporus in response to ocean acidification. We also, for the first time, examined the OA response of Calcidiscus quadriperforatus, a larger and more heavily calcified Calcidiscus congener. All Calcidiscus coccolithophores responded negatively to OA with impaired coccolith morphology and a decreased ratio of particulate inorganic to organic carbon (PIC:POC). However, strains responded variably; C. quadriperforatus showed the most sensitivity, while the most lightly calcified strain of C. leptoporus showed little response to OA. Our findings suggest that calcium carbonate production relative to organic carbon production by Calcidiscus coccolithophores may decrease in future oceans and that Calcidiscus distributions may shift if more resilient strains and species become dominant in assemblages. This study demonstrates that variable responses to OA may be strain or species specific in a way that is closely linked to physiological traits, such as cellular calcite quota.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Predictions about the ecological consequences of oceanic uptake of CO2 have been preoccupied with the effects of ocean acidification on calcifying organisms, particularly those critical to the formation of habitats (e.g. coral reefs) or their maintenance (e.g. grazing echinoderms). This focus overlooks the direct effects of CO2 on non-calcareous taxa, particularly those that play critical roles in ecosystem shifts. We used two experiments to investigate whether increased CO2 could exacerbate kelp loss by facilitating non-calcareous algae that, we hypothesized, (i) inhibit the recovery of kelp forests on an urbanized coast, and (ii) form more extensive covers and greater biomass under moderate future CO2 and associated temperature increases. Our experimental removal of turfs from a phase-shifted system (i.e. kelp- to turf-dominated) revealed that the number of kelp recruits increased, thereby indicating that turfs can inhibit kelp recruitment. Future CO2 and temperature interacted synergistically to have a positive effect on the abundance of algal turfs, whereby they had twice the biomass and occupied over four times more available space than under current conditions. We suggest that the current preoccupation with the negative effects of ocean acidification on marine calcifiers overlooks potentially profound effects of increasing CO2 and temperature on non-calcifying organisms.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We investigated the effects of pH on movement behaviors of the harmful algal bloom causing raphidophyte Heterosigma akashiwo. Motility parameters from >8000 swimming tracks of individual cells were quantified using 3D digital video analysis over a 6-h period in 3 pH treatments reflecting marine carbonate chemistry during the pre-industrial era, currently, and the year 2100. Movement behaviors were investigated in two different acclimation-to-target-pH conditions: instantaneous exposure and acclimation of cells for at least 11 generations. There was no negative impairment of cell motility when exposed to elevated PCO2 (i.e., low pH) conditions but there were significant behavioral responses. Irrespective of acclimation condition, lower pH significantly increased downward velocity and frequency of downward swimming cells (p < 0.001). Rapid exposure to lower pH resulted in 9% faster downward vertical velocity and up to 19% more cells swimming downwards (p < 0.001). Compared to pH-shock experiments, pre-acclimation of cells to target pH resulted in ~30% faster swimming speed and up to 46% faster downward velocities (all p < 0.001). The effect of year 2100 PCO2 levels on population diffusivity in pre-acclimated cultures was >2-fold greater than in pH-shock treatments (2.2 × 105 µm**2/s vs. 8.4 × 104 µm**2/s). Predictions from an advection-diffusion model, suggest that as PCO2 increased the fraction of the population aggregated at the surface declined, and moved deeper in the water column. Enhanced downward swimming of H. akashiwo at low pH suggests that these behavioral responses to elevated PCO2 could reduce the likelihood of dense surface slick formation of H. akashiwo through reductions in light exposure or growth independent surface aggregations. We hypothesize that the HAB alga's response to higher PCO2 may exploit the signaling function of high PCO2 as indicative of net heterotrophy in the system, thus indicative of high predation rates or depletion of nutrients.