351 resultados para Fam
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Foi demonstrado que uma condição em búfalos caracterizada pelo aumento de uma das bochechas é causada pelo acúmulo das sementes da palmeira "mucajá"(Acrocomia aculeata, fam. Arecaceae) e de capim no vestíbulo oral, durante a ruminação. Esse acúmulo de sementes causou atrofia por compressão com adelgaçamento e desvio medial do osso mandibular correspondente e exposição das raízes dos dentes molares. Aparentemente os frutos dessa palmeira possuem boa palatabilidade para búfalos.
Resumo:
Dentre as doenças cardiovasculares, a trombose venosa (TV) destaca-se pela associação entre fatores de riscos adquiridos e fatores genéticos. A resistência hereditária à proteína C ativada tem sido identificada como a principal causa dos casos de trombose venosa, sendo frequentemente associada à mutação fator V Leiden (G1694A). Em indivíduos homozigotos, o risco de trombose venosa é 50 a 100 vezes maior que em pacientes homozigotos normais, enquanto em pacientes heterozigotos o risco é de 5 a 10 vezes. Baseado na necessidade de avaliação e acompanhamento de pacientes com casos de trombose venosa e prevenção de seus respectivos familiares, foi desenvolvido um método simples de discriminação alélica do fator V da coagulação utilizando PCR em tempo real. Foram selecionados 67 pacientes com histórico de TV e 51 indivíduos sem histórico de TV. Primeiramente, a discriminação alélica do fator V foi realizada através de PCR convencional seguida de digestão enzimática (Mnl). Posteriormente, o diagnóstico foi realizado por PCR em tempo real. Ambos os métodos foram baseados no polimorfismo G1691A, sendo no segundo utilizado fluoróforos VIC e FAM para marcar os nucleotídeos G e A, respectivamente. A técnica de PCR-RFLP foi utilizada para diagnosticar 95 indivíduos homozigotos normais, 21 heterozigotos e 2 homozigotos FVL. Utilizando PCR em tempo real foram obtidos os mesmos resultados. A máxima similaridade entre os resultados obtidos por PCR em tempo real e PCR-RFLP indicou precisão significativa do novo método de discriminação e visualização alélica do fator V.
Resumo:
Pós-graduação em Ciências Biológicas (Zoologia) - IBRC
Resumo:
Pós-graduação em Matematica Aplicada e Computacional - FCT
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Pós-graduação em Medicina Veterinária - FCAV
Resumo:
The aim of this study was to compare the following four genetic groups of hair sheep: Santa Inês (SI), Morada Nova (MN), Brazilian Somali (BS), and the F1 1/2Dorper x 1/2Morada Nova crossbreed on traits related to growth and parasitic infection. Thirty-three male lambs of the same age and of simple birth, under the same pre-weaning management conditions were used in the experiment. After weaning the animals were housed in a completely randomized design in paddocks made of Panicum maximum cv. Tanzania. Along the course of the research, the performance of the four groups of sheep was observed to be negatively affected by gastrointestinal parasites, but there was a genotype effect to the average daily weight gain (ADWG), where the SI and F1 genotypes presented higher values. The effects of genotype, time and genotype x time interaction were significant in weight and corporal score (CS) measurements. The BS lambs had the highest CS values throughout the experiment despite not presenting greater weight gain when compared to the SI and F1 breeds. There were also significant effects of time and genotype x time interaction for packed cell volume (PCV) and FAMACHA© score (FAM) and only the time effect was significant in the total number of eggs per gram (EPG) and total plasma protein (TPP). The MN lambs showed higher PCV values and unlike the other groups, presented a FAMACHA© score below 3 and PCV above 23% even having a higher EPG tendency, especially in the initial phase, indicating a possible higher resilience to infection caused by gastrointestinal parasites.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Novel species of fungi described in the present study include the following from Malaysia: Castanediella eucalypti from Eucalyptus pellita, Codinaea acacia from Acacia mangium, Emarcea eucalyptigena from Eucalyptus brassiana, Myrtapenidiella eucalyptorum from Eucalyptus pellita, Pilidiella eucalyptigena from Eucalyptus brassiana and Strelitziana malaysiana from Acacia mangium. Furthermore, Stachybotrys sansevieriicola is described from Sansevieria ehrenbergii (Tanzania), Phacidium grevilleae from Grevillea robusta (Uganda), Graphium jumulu from Adansonia gregorii and Ophiostoma eucalyptigena from Eucalyptus marginata (Australia), Pleurophoma ossicola from bone and Plectosphaerella populi from Populus nigra (Germany), Colletotrichum neosansevieriae from Sansevieria trifasciata, Elsinoë othonnae from Othonna quinquedentata and Zeloasperisporium cliviae (Zeloasperisporiaceae fam. nov.) from Clivia sp. (South Africa), Neodevriesia pakbiae, Phaeophleospora hymenocallidis and Phaeophleospora hymenocallidicola on leaves of a fern (Thailand), Melanconium elaeidicola from Elaeis guineensis (Indonesia), Hormonema viticola from Vitis vinifera (Canary Islands), Chlorophyllum pseudoglobossum from a grassland (India), Triadelphia disseminata from an immunocompromised patient (Saudi Arabia), Colletotrichum abscissum from Citrus (Brazil), Polyschema sclerotigenum and Phialemonium limoniforme from human patients (USA), Cadophora vitícola from Vitis vinifera (Spain), Entoloma flavovelutinum and Bolbitius aurantiorugosus from soil (Vietnam), Rhizopogon granuloflavus from soil (Cape Verde Islands), Tulasnella eremophila from Euphorbia officinarum subsp. echinus (Morocco), Verrucostoma martinicensis from Danaea elliptica (French West Indies), Metschnikowia colchici from Colchicum autumnale (Bulgaria), Thelebolus microcarpus from soil (Argentina) and Ceratocystis adelpha from Theobroma cacao (Ecuador). Myrmecridium iridis (Myrmecridiales ord. nov., Myrmecridiaceae fam. nov.) is also described from Iris sp. (The Netherlands). Novel genera include (Ascomycetes): Budhanggurabania from Cynodon dactylon (Australia), Soloacrosporiella, Xenocamarosporium, Neostrelitziana and Castanediella from Acacia mangium and Sabahriopsis from Eucalyptus brassiana (Malaysia), Readerielliopsis from basidiomata of Fuscoporia wahlbergii (French Guyana), Neoplatysporoides from Aloe ferox (Tanzania), Wojnowiciella, Chrysofolia and Neoeriomycopsis from Eucalyptus (Colombia), Neophaeomoniella from Eucalyptus globulus (USA), Pseudophaeomoniella from Olea europaea (Italy), Paraphaeomoniella from Encephalartos altensteinii, Aequabiliella, Celerioriella and Minutiella from Prunus (South Africa). Tephrocybella (Basidiomycetes) represents a novel genus from wood (Italy). Morphological and culture characteristics along with ITS DNA barcodes are provided for all taxa.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)