Nonoxynol-9 spermicide for prevention of vaginally acquired HIV and other sexually transmitted infections: systematic review and meta-analysis of randomised controlled trials including more than 5000 women

We aimed to determine the effectiveness of the vaginally administered spermicide nonoxynol-9 (N-9) among women for the prevention of HIV and other sexually transmitted infections (STIs), We did a systematic review of randomised controlled trials, Nine such trials including 5096 women, predominantly sex workers, comparing N-9 with placebo or no treatment, were included. Primary outcomes were new HIV infection, new episodes of various STIs, and genital lesions. Five trials included HIV and nine included STI outcomes, and all but one (2% of the data) contributed to the meta-analysis. Overall, relative risks of HIV infection (1.12, 95% confidence interval 0.88-1.42), gonorrhoea (0.91, 0.67-1.24), chlamyclia (0.88, 0.77-1.01), cervical infection (1.01, 0.84-1-22), trichomoniasis (0.84, 0.69-1.02), bacterial vaginosis (0.88, 0.74-1.04) and candidiasis (0.97, 0.84-1.12) were not significantly different in the N-9 and placebo or no treatment groups. Genital lesions were more common in the N-9 group (1.18, 1.02-1.36). Our review has found no statistically significant reduction in risk of HIV and STIs, and the confidence intervals indicate that any protection that may exist is likely to be very small. There is some evidence of harm through genital lesions. N-9 cannot be recommended for HIV and STI prevention.

Cytokines in the oral mucosa of mice infected with Candida albicans

Oropharyngeal candidiasis is associated with defects in cell-mediated immunity, and is commonly seen in immunocompromised patients. We have previously shown that T-cell-deficient BALB/c nude (nu/nu) mice are extremely susceptible to oropharyngeal candidiasis, and that recovery from a chronic infection is dependent on CD4 T lymphocytes. In this study we describe the local tissue cytokine profile in lymphocyte-reconstituted immunodeficient mice and their euthymic counterparts. Mice were infected orally with 10(8) cells of the yeast Candida albicans , and oral tissues sampled on days 0, 4, 8, and 14. Nude mice were reconstituted with 3 x 10(7) naive lymphocytes following oral inoculation. Interleukin (IL)-6, interferon (IFN)-gamma and tumour necrosis factor (TNF)-alpha were identified in the oral tissues of infected euthymic mice recovering from oral infection, as well as naive controls. TNF-alpha was identified in nude oral tissue on days 4 and 8, but only after lymphocyte reconstitution. No IL-2, IL-4 or IL-10 was detected in either euthymic or athymic mice at any time-point throughout the experiment. This study confirms the functional activity of T lymphocytes in reconstituted nude mice, and suggests that TNF-alpha may be an important mediator in the recovery from oropharyngeal candidiasis.

Alterations in cardiac dihydropyridine receptors and calcium channel function in mdx mice

Duchenne muscular dystrophy (DMD) is a fatal neuromuscular condition affecting approximately one in 3500 live male births resulting from the lack of the myocyte protein dystrophin. The absence of dystrophin in cardiac myocytes is associated with calcium overload which in turn activates calcium-dependent proteolytic enzymes contributing to congestive heart failure, muscle necrosis and fibrosis. To date, the basis for the calcium overload has not been determined. Since L-type calcium channels are a major mediator of calcium influx we determined their potential contribution to the calcium overload. Male muscular dystrophy (mdx) mice and control C57BL10ScSn (C57) mice aged 12– 16 weeks were used in all experiments. In tissue bath studies, isolated contracting left atria from mdx revealed a reduced potency to the dihydropyridine (DHP) agonist BayK8644 and antagonist nifedipine (P < 0.05). Similarly, radioligand binding studies using the DHP antagonist [3H]-PN 200-110 showed a reduced potency (P < 0.05) in isolated membranes, associated with an increased receptor density (P < 0.05). The increased receptor density was supported by RT-PCR experiments revealing increased RNAfor the DHP receptor. Patch clamp studies revealed the presence of a diltiazem sensitive calcium current that showed delayed inactivation in isolated mdx myocytes (P < 0.01). In conclusion, the increased number of DHP binding sites and the delay in L-type current inactivation may both contribute to increased calcium influx and hence calcium overload in the dystrophin deficient mdx cardiac myocytes.

DISCORDANCE FOR RETINITIS PIGMENTOSA IN TWO MONOZYGOTIC TWIN PAIRS

Background: Retinitis pigmentosa (RP) is a group of genetically heterogeneous diseases with progressive degeneration of the retina. The condition can be inherited as an autosomal dominant, autosomal recessive, and X-linked trait. Methods: We report on two female twin pairs. One twin of each pair is affected with RP, the other twin is unaffected, both clinically and functionally. Molecular analysis in both twins included zygosity determination, arrayed primer extension chip analysis for autosomal recessive and dominant RP, sequencing of the entire RPGR gene, and analysis of X-chromosome inactivation status. Results: Both unrelated twin pairs were genetically identical. Of the potential pathogenetic mechanisms, skewed X-inactivation was excluded on leukocytes. Autosomal recessive RP and autosomal dominant RP arrayed primer extension chip analysis result was completely normal, excluding known mutations in known genes as the cause of disease in the affected twins. Sequencing excluded mutations in RPGR. A postzygotic recessive or dominant genetic mutation of an RP gene is not impossible. A postfertilization error as a potential cause of uniparental isodisomy is unlikely albeit not entirely impossible. Conclusion: The authors report on the second and third unrelated identical twin pair discordant for RP. The exact cause of the condition and the explanation of the clinical discordance remain elusive. RETINA 31:1164-1169, 2011

Repetitive Transcranial Magnetic Stimulation Is Efficacious as an Add-On to Pharmacological Therapy in Complex Regional Pain Syndrome (CRPS) Type I

Single session repetitive transcranial magnetic stimulation (rTMS) of the motor cortex (M1) is effective in the treatment of chronic pain patients but the analgesic effect of repeated sessions is still unknown We evaluated the effects of rTMS in patients with refractory pain due to complex regional pain syndrome (CRPS) type I Twenty three patients presenting CRPS type I of 1 upper limb were treated with the best medical treatment (analgesics and adjuvant medications physical therapy) plus 10 daily sessions of either real (r) or sham (s) 10Hz rTMS to the motor cortex (M1) Patients were assessed daily and after 1 week and 3 months after the last session using the Visual Analogical Scale (VAS) the McGill Pain Questionnaire (MPQ) the Health Survey 36 (SF 36) and the Hamilton Depression (HDRS) During treatment there was a significant reduction in the VAS scores favoring the r rTMS group mean reduction of 4 65 cm (50 9%) against 2 18 cm (24 7%) in the s rTMS group The highest reduction occurred at the tenth session and correlated to improvement in the affective and emotional subscores of the MPQ and SF 36 Real rTMS to the M1 produced analgesic effects and positive changes in affective aspects of pain in CRPS patients during the period of stimulation Perspective This study shows an efficacy of repetitive sessions of high frequency rTMS as an add on therapy to refractory CAPS type I patients It had a positive effect in different aspects of pain (sensory discriminative and emotional affective) It opens the perspective for the clinical use of this technique (C) 2010 by the American Pain Society

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Increased tissue resistance in the nude mouse against Candida albicans without altering strain-dependent differences in susceptibility

Strain differences in tissue responses to infection with Candida albicans were examined in nude mice having susceptible (CBA/CaH) and resistant (BALB/c) parentage. Homozygous (nu/nu) mice of both strains were more resistant to systemic infection with C. albicans than heterozygous (nu/+) littermates as indicated by a reduction in both the severity of tissue damage and colony counts in the brain and kidney. However, the tissue lesions in nu/nu CBA/CaH mice were markedly more severe than those in nu/nu mice with the BALB/c background. This pattern was reflected in the greater fungal burden in the CBA/CaH strain. Analysis of cDNA from infected tissues using a competitive polymerase chain reaction excluded interferon-gamma (IFN-gamma), tumour necrosis factor-alpha (TNF-alpha), and interleukin 6 (IL-6) as mediators of the enhanced resistance of the nude mice. The results confirm that the different patterns of lesion severity in BALB/c and CBA/CaH mice do not involve T lymphocyte-mediated pathology, and are consistent with the hypothesis that strain-dependent tissue damage is not dependent on the effector function of macrophages or their precursors.

Relationship between use of technology and employment rates for people with physical disabilities in Australia: Implications for education and training programmes

This study examined the impact of computer and assistive device use on the employment status and vocational modes of people with physical disabilities in Australia. A survey was distributed to people over 15 years in age with physical disabilities living in the Brisbane area. Responses were received from 82 people, including those with spinal cord injuries, cerebral palsy and muscular dystrophy. Of respondents 46 were employed, 22 were unemployed, and 12 were either students or undertaking voluntary work. Three-quarters of respondents used a computer in their occupations, while 15 used assistive devices. Using logistic regression analysis it was found that gender, education, level of computer skill and computer training were significant predictors of employment outcomes. Neither the age of respondent nor use of assistive software were significant predictors. From information obtained in this study guidelines for a training programme designed to maximize the employability of people with physical disabilities were developed.

MHC class I and II expression in juvenile dermatomyositis skeletal muscle

Objective To assess MHC I and II expressions in muscle fibres of juvenile dermatomyositis (JDM) and compare with the expression in polymyositis (PM), dermatomyositis (DM) and dystrophy. Patients and methods Forty-eight JDM patients and 17 controls (8 PM, 5 DM and 4 dystrophy) were studied. The mean age at disease onset was 7.1 +/- 3.0 years and the mean duration of weakness before biopsy was 9.4 +/- 12.9 months. Routine histochemistry and immunohistochemistry (StreptABComplex/HRP) for MHC I and II (Dakopatts) were performed on serial frozen muscle sections in all patients. Mann-Whitney, Kruskal Wallis, chi-square and Fisher`s exact statistical methods were used. Results MHC I expression was positive in 47 (97.9%) JDM cases. This expression was observed independent of time of disease corticotherapy previous to muscle biopsy and to the grading of inflammation observed in clinical, laboratorial and histological parameters. The expression of MHC I was similar on JDM, PM and DM, and lower in dystrophy. On the other hand, MHC II expression was positive in just 28.2% of JDM cases was correlated to histological features as inflammatory infiltrate, increased connective tissue and VAS for global degree of abnormality (p < 0.05). MCH II expression was similar in DM/PM and lower in JDM and dystrophy, and it was based on the frequency of positive staining rather than to the degree of the MCH II expression. Conclusions MHC I expression in muscle fibres is a premature and late marker of JDM patient independent to corticotherapy, and MHC II expression was lower in JDM than in PM and DM.

Dual candidemia detected by nested polymerase chain reaction in two critically ill children

The use of improved microbiological procedures associated with molecular techniques has increased the identification of Candida bloodstream infections, even if the isolation of more than one species by culture methods remains uncommon. We report the cases of two children presenting with severe gastrointestinal disorders and other risk factors that contribute to Candida infections. In the first patient, C. albicans DNA was initially detected by a nested-amplification and C. tropicalis was found later during hospitalization, while blood cultures were persistently negative. In the second child, there was amplification of C. albicans and C. glabrata DNA in the same samples, but blood cultures yielded only C. albicans. Both patients received antifungal therapy but had unfavorable outcomes. These two cases illustrate that PCR was more successful than culture methods in detecting Candida in the bloodstream of high risk children, and was also able to detect the presence of more than one species in the same patient that might impact therapy when the fungi are resistant to azole compounds.

Perspectives on sexual and reproductive health among women in an ancient mining area in Brazil

The purpose of this study was to describe the reproductive profile and frequency of genital infections among women living in the Serra Pelada, a former mining village in the Para state, Brazil. A descriptive study of women living in the mining area of Serra Pelada was performed in 2004 through interviews that gathered demographics and clinical data, and assessed risk behaviors of 209 randomly-selected women. Blood samples were collected for rapid assay for HIV; specimens were taken for Pap smears and Gram stains. Standard descriptive statistical analyses were performed and prevalence was calculated to reflect the relative frequency of each disease. Of the 209 participants, the median age was 38 years, with almost 70% having less than four years of education and 77% having no income or under 1.9 times the minimum wage of Brazil. About 30% did not have access to health care services during the preceding year. Risk behaviors included: alcohol abuse, 24.4%; illicit drug abuse, 4.3%; being a sex worker, 15.8%; and domestic violence, 17.7%. Abnormal Pap smear was found in 8.6%. Prevalence rates of infection were: HIV, 1.9%; trichomoniasis, 2.9%; bacterial vaginosis, 18.7%; candidiasis, 5.7%; Chlamydial-related cytological changes, 3.3%; and HPV-related cytological changes, 3.8%. Women living in this mining area in Brazil are economically and socially vulnerable to health problems. It is important to point out the importance of concomitant broader strategies that include reducing poverty and empowering women to make improvements regarding their health.

Trisomy 16q21 -> qter: Seven-Year Follow-Up of a Girl With Unusually Long Survival

The 16q21 -> qter duplication is a chromosomal abnormality rarely found in liveborn infants, with only four published cases. We report here on the 7-year follow-up of a female patient with trisomy 16q21 -> qter due to a maternal balanced translocation t(4;16)(q35.2;q21). The patient shows severe mental retardation, congenital heart malformations, nephropathy, and other congenital anomalies. The derivative chromosome was characterized by GTG banding, fluorescent in situ hybridization (FISH) with different BAG probes and the array technique, in order to map the breakpoints. The patient has a 16q21 -> qter duplication, with a 4q35 -> qter monosomy, which we assume does not contribute to the abnormal phenotype. This is the first reported case of postnatal survival to the age of 7 years, an unusually long time in this chromosomal syndrome. (C) 2010 Wiley-Liss, Inc.

Esophageal CandidiasisAn Adverse Effect of Inhaled Corticosteroids Therapy

Over the last few decades, inhaled corticosteroids (ICs) became the cornerstone in the treatment of persistent asthma. Their use improved asthma control, decreased mortality and also minimized adverse reactions associated with systemic steroid. Esophageal candidiasis is a rare complication resulting from the use of ICs. Although, in recent years, as their prescriptions has increased, more cases have been reported, especially in Japan. Listed are 4 case reports regarding esophageal candidiasis in asthmatic patients associated with inhaled budesonide administration. In the cases reported herein, the use of a different device of dry powder budesonide might have favored esophageal drug deposition and Candida infection. Patients denied using systemic corticosteroids in the previous 6 months. Furthermore, none of the patients presented Diabetes mellitus, malignant disease, HIV infection, or other immunosuppressive conditions. We conclude that patients treated with high doses of ICs are at higher risk of developing esophageal candidiasis. These patients should undergo upper gastrointestinal endoscopy whenever they present symptoms. Nevertheless, we must keep in mind that infection might also be asymptomatic and esophageal candidiasis prevalence may be higher than that reported thus far.

Effect of NF kappa B Inhibition by CAPE on Skeletal Muscle Ischemia-Reperfusion Injury

Background/Aims. Nuclear factor kappa B (NF kappa B) plays important role in the pathogenesis of skeletal muscle ischemia/reperfusion (I/R) injury. Caffeic acid phenyl ester (CAPE), a potent NF kappa B inhibitor, exhibits protective effects on I/R injury in some tissues. In this report, the effect of CAPE on skeletal muscle I/R injury in rats was studied. Methods. Wistar rats were submitted to sham operation, 120-min hindlimb ischemia, or 120-min hindlimb ischemia plus saline or CAPE treatment followed by 4-h reperfusion. Gastrocnemius muscle injury was evaluated by serum aminotransferase levels, muscle edema, tissue glutathione and malondialdehyde measurement, and scoring of histological damage. Apoptotic nuclei were determined by a terminal uridine deoxynucleotidyl transferase dUTP nick end labeling assay. Muscle neutrophil and mast cell accumulation were also assessed. Lipoperoxidation products and NF kappa B were evaluated by 4-hydroxynonenal and NF kappa B p65 immunohistochemistry, respectively. Results. Animals submitted to ischemia showed a marked increase in aminotransferases after reperfusion, but with lower levels in the CAPE group. Tissue glutathione levels declined gradually during ischemia to reperfusion, and were partially recovered with CAPE treatment. The histological damage score, muscle edema percentage, tissue malondialdehyde content, apoptosis index, and neutrophil and mast cell infiltration, as well as 4-hydroxynonenal and NF kappa B p65 labeling, were higher in animals submitted to I/R compared with the ischemia group. However, the CAPE treatment significantly reduced all of these alterations. Conclusions. CAPE was able to protect skeletal muscle against I/R, injury in rats. This effect may be associated with the inhibition of the NF kappa B signaling pathway and decrease of the tissue inflammatory response following skeletal muscle I/R. (C) 2009 Elsevier Inc. All rights reserved.