NMR in Crystals and Powders of Topazes with Different Colours

The present work is a part of the large project with purpose to investigate microstructure and electronic structure of natural topazes using NMR method. To reach this task we determined the relative contents of fluorine and hydrogen in crystals blue, colorless, wine and wine irradiated topazes. Then we determined the electric field gradients in site of aluminium atoms by NMR method, calculated EFG using ab initio method, and measured relaxation time dependence on heating temperature for blue, colorless, Swiss blue and sky blue topazes. Nuclear magnetic resonance (NMR) is an effective method to investigate the local structure in the crystal. The NMR study of the single crystal gives detailed information especially about the local crystal structure. As a result of this work we have received practical data, which is possible to use in future for making personal dosimetry and for preparation of mullite, which is widely used in traditional and advanced ceramic materials.

Stepwise self-assembly of a tripeptide from molecular dimers to supramolecular beta-sheets in crystals and amyloid-like fibrils in the solid state

The terminally protected tripeptide Boc-Ala(1)-Leu(2)-Ala(3)-OMe 1 forms antiparallel hydrogen-bonded dimers of two different conformers in the asymmetric unit and the individual dimers then self-associate to form supramolecular beta-sheet structures in crystals and amyloid-like fibrils in the solid state.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Impact of geographical region on urinary metabolomic and plasma fatty acid profiles in subjects with the metabolic syndrome across Europe: the LIPGENE study

The application of metabolomics in multi-centre studies is increasing. The aim of the present study was to assess the effects of geographical location on the metabolic profiles of individuals with the metabolic syndrome. Blood and urine samples were collected from 219 adults from seven European centres participating in the LIPGENE project (Diet, genomics and the metabolic syndrome: an integrated nutrition, agro-food, social and economic analysis). Nutrient intakes, BMI, waist:hip ratio, blood pressure, and plasma glucose, insulin and blood lipid levels were assessed. Plasma fatty acid levels and urine were assessed using a metabolomic technique. The separation of three European geographical groups (NW, northwest; NE, northeast; SW, southwest) was identified using partial least-squares discriminant analysis models for urine (R 2 X: 0•33, Q 2: 0•39) and plasma fatty acid (R 2 X: 0•32, Q 2: 0•60) data. The NW group was characterised by higher levels of urinary hippurate and N-methylnicotinate. The NE group was characterised by higher levels of urinary creatine and citrate and plasma EPA (20 : 5 n-3). The SW group was characterised by higher levels of urinary trimethylamine oxide and lower levels of plasma EPA. The indicators of metabolic health appeared to be consistent across the groups. The SW group had higher intakes of total fat and MUFA compared with both the NW and NE groups (P≤ 0•001). The NE group had higher intakes of fibre and n-3 and n-6 fatty acids compared with both the NW and SW groups (all P< 0•001). It is likely that differences in dietary intakes contributed to the separation of the three groups. Evaluation of geographical factors including diet should be considered in the interpretation of metabolomic data from multi-centre studies.

Rayleigh scattering by hexagonal ice crystals and the interpretation of dual-polarisation radar measurements

Dual-polarisation radar measurements provide valuable information about the shapes and orientations of atmospheric ice particles. For quantitative interpretation of these data in the Rayleigh regime, common practice is to approximate the true ice crystal shape with that of a spheroid. Calculations using the discrete dipole approximation for a wide range of crystal aspect ratios demonstrate that approximating hexagonal plates as spheroids leads to significant errors in the predicted differential reflectivity, by as much as 1.5 dB. An empirical modification of the shape factors in Gans's spheroid theory was made using the numerical data. The resulting simple expressions, like Gans's theory, can be applied to crystals in any desired orientation, illuminated by an arbitrarily polarised wave, but are much more accurate for hexagonal particles. Calculations of the scattering from more complex branched and dendritic crystals indicate that these may be accurately modelled using the new expression, but with a reduced permittivity dependent on the volume of ice relative to an enclosing hexagonal prism.

Effect of Different Solvent Ratios (Water/Ethylene Glycol) on the Growth Process of CaMoO(4) Crystals and Their Optical Properties

In this paper, calcium molybdate (CaMoO(4)) crystals (meso- and nanoscale) were synthesized by the coprecipitation method using different solvent volume ratios (water/ethylene glycol). Subsequently, the obtained suspensions were processed in microwave-assisted hydrothermal/solvothermal systems at 140 degrees C for 1 h. These meso- and nanocrystals processed were characterized by X-ray diffraction (X R I)), Fourier transform Raman (FT-Raman), Fourier transform infrared (FT-IR). ultraviolet visible (UV-vis) absorption spectroscopies, held-emission gun scanning electron microscopy (FEG-SEM). transmission electron microscopy (TEM). and photoluminescence (PL) measurements. X RI) patterns and FT-Raman spectra showed that these meso- and nanocrystals have a scheelite-type tetragonal structure without the presence of deleterious phases. FT-IR spectra exhibited a large absorption band situated at around 827 cm(-1), which is associated with the Mo-O anti-symmetric stretching vibrations into the [MoO(4)] clusters. FEG-SEM micrographs indicated that the ethylene glycol concentration in the aqueous solution plays an important role in the morphological evolution of CaMoO(4) crystals. High-resolution TEM micrographs demonstrated that the mesocrystals consist of several aggregated nanoparticles with electron diffraction patterns of monocrystal. In addition, the differences observed in the selected area electron diffraction patterns of CaMoO(4) crystals proved the coexistence of both nano- and mesostructures, First-principles quantum mechanical calculations based on the density functional theory at the B3LYP level were employed in order to understand the band structure find density of states For the CaMoO(4). UV-vis absorption measurements evidenced a variation in optical band gap values (from 3.42 to 3.72 cV) for the distinct morphologies. The blue and green PI. emissions observed in these crystals were ascribed to the intermediary energy levels arising from the distortions on the [MoO(4)] clusters clue to intrinsic defects in the lattice of anisotropic/isotropic crystals.

Urinary incontinence and vaginal squeeze pressure two years post-cesarean delivery in primiparous women with previous gestational diabetes mellitus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Urinary lithiasis and idiopathic hypercalciuria: the importance of dietary intake evaluation

PUSPOSE: To evaluate food intake of patients with urinary lithiasis and idiopathic hypercalciuria (IH). MATERIALS and METHODS: Between August 2007 and June 2008, 105 patients with lithiasis were distributed into 2 groups: Group 1 (n = 55) - patients with IH (urinary calcium excretion > 250 mg in women and 300 mg in men with normal serum calcium); Group 2 (n = 50) - normocalciuria (NC) patients . Inclusion criteria were: age over 18, normal renal function (creatinine clearance = 60 mL/min), absent proteinuria and negative urinary culture. Pregnant women, patients with some intestinal pathology, chronic diarrhea or using corticoids were excluded. The protocol of metabolic investigation was based on non-consecutive collection of two 24-hour samples for dosages of: calcium, sodium, uric acid, citrate, oxalate, magnesium and urinary volume. Food intake was evaluated through the quantitative method of Dietary Register of three days. RESULTS: Urinary excretion of calcium (433.33 ± 141.92 vs. 188.93 ± 53.09), sodium (280.08 ± 100.94 vs. 200.44.93 ± 65.81), uric acid (880.63 ± 281.50 vs. 646.74 ± 182.76) and magnesium (88.78 ± 37.53 vs. 64.34 ± 31.84) was significantly higher in the IH group in comparison to the NC group (p < 0.05). As regards the nutritional composition of food intake of IH and NC groups, there was no statistical significant difference in any nutrient evaluated. CONCLUSION: In our study, no difference was observed in the food intake of patients with urinary lithiasis and IH or NC.

Nitric oxide of the supraoptic nucleus influences the salivary secretion, sodium renal excretion, urinary volume and arterial blood pressure induced by pilocarpine

Male Holtzman rats weighting 200-250 g were anesthetized with zoletil 50 mg/Kg (tiletamine chloridrate 125.0 mg and zolazepan chloridrate 125.0 mg) into quadriceps muscle and stainless steel cannulas were implanted into their supraoptic nucleus (SON). We investigated the effects of the injection into the supraoptic nucleus (SON) of FK 409, a nitric oxide donor, and N(W-)nitro-L-arginine methyl ester (L-NAME), a nitric oxide synthase inhibitor (NOS), on the salivary secretion, arterial blood pressure, sodium excretion and urinary volume induced by pilocarpine, which was injected into SON. The drugs were injected in 0.5 mul volume over 30-60 s. Controls was injected with a similar volume of 0.15 M NaCl. FK 409 and L-NAME were injected at doses of 20 mug/0.5 mul and 40 mug/0.5 mul. respectively. The amount of saliva secretion was studied over a five-minute period after injection of pilocarpine into SON. Injection of pilocarpine (10, 20, 40, 80, 160 mug/mul) into SON produced a dose-dependent increase in salivary secretion. L-NAME was injected into SON prior to the injection of pilocarpine into SON, producing an increase in salivary secretion due to the effect of pilocarpine. FK 409 injected into SON attenuating the increase in salivary secretion induced by pilocarpine. Mean arterial pressure (MAP) increase after injections of pilocarpine into the SON. L-NAME injected into the SON prior to injection of pilocarpine into SON increased the MAP. FK 409 injected into the SON prior to pilocarpine attenuated the effect of pilocarpine on MAP. Pilocarpine (0.5 mumol/0.5 mul) injected into the SON induced an increase in sodium and urinary excretion. L-NAME injected prior to pilocarpine into the SON increased the urinary sodium excretion and urinary volume induced by pilocarpine. FK 409 injected prior to pilocarpine into the SON decreased the sodium excretion and urinary volume induced by pilocarpine. All these roles of pilocarpine depend on the release of nitric oxide into the SON. In summary the present results show: a) SON is involved in pilocarpine-induced salivation; b) that mechanism involves increase in MAP, sodium excretion and urinary volume. (C) 2003 Elsevier B.V. All rights reserved.

Grain-boundary segregation and precipitates in La2O3 and Pr2O3 doped SnO2 center dot CoO-based varistors

Structural heterogeneities in SnO2.CoO-based varistors were analyzed by transmission electron microscopy. In SnO2.CoO-based system doped with La2O3 and Pr2O3 two kinds of precipitate phases at grain boundary region were found. Using energy dispersive spectrometry they were found to be Co2SnO4 and Pr2Sn2O7, presenting a defined crystalline structure. It was also identified that such precipitate phases are mainly located in triple-junctions of the microstructure. HRTEM analysis revealed the existence of other two types of junctions, one as being homo-junctions of SnO2 grains and other due to twin grain boundaries inside the SnO2.CoO grain. The role of these types of junction in the overall nonlinear electrical features is also discussed. (C) 2003 Elsevier B.V. Ltd. All rights reserved.