Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Synthesis and structural studies of (1,10-phenanthroline)(thiocyanate-N)-(triphenylphosphine)copper(I)

The compound (1,10-phenanthroline)(thiocyanate-N)(triphenylphosphine)copper(I), was synthesized and studied by IR spectroscopy and X-ray diffraction techniques. It is monomeric with the thiocyanate acting as a N-donor ligand. The copper atom shows a distorted tetrahedral coordination geometry.

Crystallographic and spectroscopic studies on palladium(II) complexes containing pyrazole and thiocyanate ligands

Mononuclear palladium(II) complexes containing both pyrazole-type ligands and thiocyanate, of general formula [Pd(SCN) 2(L) 2] {L = pyrazole (HPz) and l-phenyl-3-methylpyrazole (phmPz)} have been prepared and characterized by elemental analysis, i.r. and n.m.r. spectroscopy and by single crystal X-ray diffraction methods. The Pd atom in these structures lies on the crystallographic inversion center; in a square-planar coordination geometry made by two sulfur and two nitrogen atoms of the ligands, both in trans positions.

Thermal analysis of coordination compounds. Part 1. Thermodecomposition of nickel(II) triphenylphosphine complexes with halides, nitrate, and thiocyanate

The compounds [NiX 2(PPh 3) 2] (where X is Cl -, Br -, I -, NO - 3, NCS -; and PPh 3 is triphenylphosphine) were prepared and characterized by infrared and atomic absorption spectroscopies and by carbon and hydrogen analyses. Simultaneous thermogravimetric (TG) and derivative thermogravimetric (DTG) curves of these complexes were recorded in air. The decrease in mass observed indicates conversion of the complexes to oxides. The thermal decomposition of the halogen and nitrate complexes occurred in a number of steps; the thiocyanate complex decomposed in a single step. © 1994.

High-throughput procedure for tick surveys of tick-borne encephalitis virus and its application in a national surveillance study in Switzerland

Tick-borne encephalitis (TBE), a viral infection of the central nervous system, is endemic in many Eurasian countries. In Switzerland, TBE risk areas have been characterized by geographic mapping of clinical cases. Since mass vaccination should significantly decrease the number of TBE cases, alternative methods for exposure risk assessment are required. We established a new PCR-based test for the detection of TBE virus (TBEV) in ticks. The protocol involves an automated, high-throughput nucleic acid extraction method (QIAsymphony SP system) and a one-step duplex real-time reverse transcription-PCR (RT-PCR) assay for the detection of European subtype TBEV, including an internal process control. High usability, reproducibility, and equivalent performance for virus concentrations down to 5 x 10(3) viral genome equivalents/microl favor the automated protocol compared to the modified guanidinium thiocyanate-phenol-chloroform extraction procedure. The real-time RT-PCR allows fast, sensitive (limit of detection, 10 RNA copies/microl), and specific (no false-positive test results for other TBEV subtypes, other flaviviruses, or other tick-transmitted pathogens) detection of European subtype TBEV. The new detection method was applied in a national surveillance study, in which 62,343 Ixodes ricinus ticks were screened for the presence of TBE virus. A total of 38 foci of endemicity could be identified, with a mean virus prevalence of 0.46%. The foci do not fully agree with those defined by disease mapping. Therefore, the proposed molecular test procedure constitutes a prerequisite for an appropriate TBE surveillance. Our data are a unique complement of human TBE disease case mapping in Switzerland.

A new 1D bimetallic thiocyanate-bridged copper(II)–cobalt(II) compound

The crystal structure of the first one-dimensional hetero-metallic compound containing thiocyanate as bridging ligands,{[Cu(cyclam)][Co(NCS)4]}n, has been determined, togetherwith a preliminary study of the magnetic properties.

A new bidimensional compound containing (μ-thiocyanate)(bpy)copper(II) molecules: synthesis, crystal structure and magnetic properties of [Cu(bpy)(NCS)2]n (bpy = 2,2'-bipyridyl)

The crystal structure of the first bidimensional copper(II) compound containing only thiocyanate as bridging ligands [Cu(bpy)(NCS) 2 ] n , where bpy=2,2'-bipyridyl, has been determined by X-ray diffraction on single-crystals. Two different environments for both types of copper(II) ions in the unit cell are apparent: a distorted octahedron and a square pyramid. A bidimensional structure with a deformed honeycomb-layer motif is formed, the bipyridyl ligands filling the interlayer space. The magnetic susceptibility data of the compound have been investigated between 280 and 1.8 K. The compound presents a very weak antiferromagnetic interaction that has been fitted by using the Bleaney-Bowers expression for a dimeric unit, whereby a J value of -1.01(1) cm - 1 (H=-JS 1 .S 2 ) and a g value of 2.08(1) have been obtained.

Guanidinium-cholesterol cationic lipids: efficient vectors for the transfection of eukaryotic cells.

Two cationic lipids, bis-guanidinium-spermidine-cholesterol (BGSC) and bis-guanidinium-trencholesterol (BGTC)-cholesterol derivatives bearing two guanidinium groups-have been synthesized and tested as artificial vectors for gene transfer. They combine the membrane compatible features of the cholesterol subunit and the favorable structural and high pKa features of the guanidinium functions for binding DNA via its phosphate groups. Reagent BGTC is very efficient for transfection into a variety of mammalian cell lines when used as a micellar solution. In addition, both BGTC and BGSC present also a high transfection activity when formulated as liposomes with the neutral phospholipid dioleoylphosphatidyl ethanolamine. These results reveal the usefulness of cholesterol derivatives bearing guanidinium groups for gene transfer.

The microbiological destruction of thiocyanate in activated sludge plants treating coke oven effluent

The treatment of effluents produced during the manufacture of metallurgical coke is normally carried out using the activated sludge process. The efficiency of activated sludges in purifying coke oven effluent depends largely on the maintenance of species of micro-organisms which destroy thiocyanate. The composition, production, toxicity and treatment of coke oven effluent at Corby steelworks are described. A review is presented which follows the progress made towards identifying and monitoring the species of bacteria which destroy thiocyanate in biological treatment plants purifying coke oven effluents. In the present study a search for bacteria capable of destroying thiocyanate led to the isolation of a species of bacteria, identified as Pseudomonas putida, which destroyed thiocyanate in the presence of succinate; this species had not previously been reported to use thiocyanate. Washed cell suspensions of P. putida destroyed phenol and thiocyanate simultaneously and thiocyanate destruction was not suppressed by pyridine, aniline or catechol at the highest concentrations normally encountered in coke oven effluent. The isolate has been included, as N.C.I.B. 11198, in the National Collection of Industrial Bacteria, Torrey Research Station, Aberdeen. Three other isolates, identified as Achromobacter sp., Thiobacillus thioparus and T. denitrificans, were also confirmed to destroy thi.ocyanate. A technique has been developed for monitoring populations of different species of bacteria in activated sludges. Application of this technique to laboratory scale and full scale treatment plants at Corby showed that thiobacilli were usually not detected; thiobacilli were el~inated during the commissioning period of the full scale plant. However experiments using a laboratory scale plant indicated that during a period of three weeks an increase in the numbers of thiobacilli might have contributed to an improvement in plant performance. Factors which might have facilitated the development of thiobacilli are discussed. Large numbers of fluorescent pseudomonads capable of using thiocyanate were sometimes detected in the laboratory scale plant. The possibility is considered that catechol or other organic compounds in the feed-liquor might have stimulated fluorescent pseudmonads. Experiments using the laboratory scale plant confirmed that deteriorations in the efficiency of thiocyanate destruction were sometimes caused by bulking sludges, due to the excessive growth of fungal floes. Increased dilution of the coke oven effluent was a successful remedy to this difficulty. The optimum operating conditions recommended by the manufacturer of the full scale activated sludge plant at Corby are assessed and the role of bacterial monitoring in a programme of regular monitoring tests is discussed in relation to the operation of activated sludge plants treating coke oven effluents.

A more reliable PCR for detection of Mycobacterium tuberculosis in clinical samples

Diagnostic techniques based on PCR have two major problems: false-positive reactions due to contamination with DNA fragments from previous PCRs (amplicons) and false-negative reactions caused by inhibitors that interfere with the PCR. We have improved our previously reported PCR based on the amplification of a fragment of the Mycobacterium tuberculosis complex-specific insertion element IS6110 with respect to both problems. False-positive reactions caused by amplicon contamination were prevented by the use of uracil-N-glycosylase and dUTP instead of dTTP. We selected a new set of primers outside the region spanned by the formerly used primers to avoid false-positive reactions caused by dTTP-containing amplicons still present in the laboratory. With this new primer set, 16 copies of the IS6110 insertion element, the equivalent of two bacteria, could be amplified 10(10) times in 40 cycles, resulting in a mean efficiency of 77% per cycle. To detect the presence of inhibitors of the Taq polymerase, which may cause false-negative reactions, part of each sample was spiked with M. tuberculosis DNA. The DNA purification method using guanidinium thiocyanate and diatoms effectively removed most or all inhibitors of the PCR. However, this was not suitable for blood samples, for which we developed a proteinase K treatment followed by phenol-chloroform extraction. This method permitted detection of 20 M. tuberculosis bacteria per ml of whole blood. Various laboratory procedures were introduced to reduce failure or inhibition of PCR and avoid DNA cross contamination. We have tested 218 different clinical specimens obtained from patients suspected of having tuberculosis. The samples included sputum (n=145), tissue biopsy samples (n=25), cerebrospinal fluid (n=15), blood (n=14), pleural fluid (n=9), feces, (n=7), fluid from fistulae (n=2), and pus from a wound (n=1). The results obtained by PCR were consistent with those obtained with culture, which is the "gold standard." We demonstrate that PCR is a useful technique for the rapid diagnosis of tuberculosis at various sites.

Comparative analysis of the gas-phase reactions of cylindrospermopsin and the difference in the alkali metal cation mobility

Cylindrospermopsin (CYN) belongs to a group of toxins produced by several strains of freshwater cyanobacteria. It is a compact zwitterionic molecule composed of a uracil section and a tricyclic guanidinium portion with a primarily hepatotoxic effect. Using low multi-stage and high-resolution mass spectrometry, the gas-phase reactions of this toxin have been investigated. Our data show that collision-induced dissociation (CID) spectra of CYN are dominated by neutral losses, and three major initial fragmentation pathways are clearly distinguishable. Interestingly, comparative analysis of protonated and cationizated molecules showed a significant difference in the balance of the SO(3) and terminal ring elimination. These data indicate that the differential ion mobility of H(+), Li(+), Na(+) and K(+) leads to different fragmentation pathways, giving rise to mass spectra with different profiles. Copyright (C) 2008 John Wiley & Sons, Ltd.

Refolding and purification of the human secreted group IID phospholipase A(2) expressed as inclusion bodies in Escherichia coli

The secreted phospholipases A(2) (sPLA(2)s) are water-soluble enzymes that bind to the surface of both artificial and biological lipid bilayers and hydrolyze the membrane phospholipids. The tissue expression pattern of the human group IID secretory phospholipase A(2) (hsPLA(2)-IID) suggests that the enzyme is involved in the regulation of the immune and inflammatory responses. With an aim to establish an expression system for the hsPLA(2)-IID in Escherichia coli, the DNA-coding sequence for hsPLA(2)-IID was subcloned into the vector pET3a, and expressed as inclusion bodies in E. coli (BL21). A protocol has been developed to refold the recombinant protein in the presence of guanidinium hydrochloride, using a size-exclusion chromatography matrix followed by dilution and dialysis to remove the excess denaturant. After purification by cation-exchange chromatography, far ultraviolet circular dichroism spectra of the recombinant hsPLA(2)-IID indicated protein secondary structure content similar to the homologous human group IIA secretory phospholipase A(2). The refolded recombinant hsPLA(2)-IID demonstrated Ca(2+)-dependent hydrolytic activity, as measuring the release free fatty acid from phospholipid liposomes. This protein expression and purification system may be useful for site-directed mutagenesis experiments of the hsPLA(2)-IID which will advance our understanding of the structure-function relationship and biological effects of the protein. (C) 2009 Elsevier Inc. All rights reserved.

Analysis of marine bivalve shellfish from the fish market in Santos city, Sao Paulo state, Brazil, for Toxoplasma gondii

The aim of this study was to determine if Toxoplasma gondii are present in oysters (Crassostrea rhizophorae) and mussels (Mytella guyanensis) under natural conditions using a bioassay in mice and molecular detection methods. We first compared two standard protocols for DNA extraction, phenol-chloroform (PC) and guanidine-thiocyanate (GT), for both molluscs. A total of 300 oysters and 300 mussels were then acquired from the fish market in Santos city, Sao Paulo state, Brazil, between March and August of 2008 and divided into 60 groups of 5 oysters and 20 groups of 15 mussels. To isolate the parasite, five mice were orally inoculated with sieved tissue homogenates from each group of oysters or mussels. For molecular detection of T. gondii, DNA from mussels was extracted using the PC method and DNA from oysters was extracted using the GT method. A nested-PCR (Polymerase Chain Reaction) based on the amplification of a 155 bp fragment from the B1 gene of T. gondii was then performed. Eleven PCR-RFLP (Restriction Fragment Length Polymorphism) markers, SAG1, SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1, CS3 and Apico, were used to genotype positive samples. There was no isolation of the parasite by bioassay in mice. T. gondii was not detected in any of the groups of mussels by nested-PCR. DNA of T. gondii was apparently detected by nested-PCR in 2 groups of oysters (3.3%). Genotyping of these two positive samples was not successful. The results suggest that oysters of the species C. rhizophorae, the most common species from the coast of Sao Paulo, can filter and retain T. gondii oocysts from the marine environment. Ingestion of raw oysters as a potential transmission source of T. gondii to humans and marine mammals should be further investigated. (C) 2010 Elsevier B.V. All rights reserved.

Crown ether appended cyclam receptors for cationic guests

A series of crown ether appended macrocyclic amines has been prepared comprising benzo-12-crown-4, benzo-15-crown-5, or benzo-18-crown-6 attached to a diamino-substituted cyclam. The Co-III complexes of these three receptors have been prepared and characterized spectroscopically and structurally. Crystal structures of each receptor in complex with an alkali metal ion and structures of the benzo-12-crown-4 and benzo-15-crown-5-receptors without guest ions are reported. 2D NMR and molecular mechanics modeling have been used to examine conformational variations upon guest ion complexation. Addition of cations to these receptors results in an appreciable anodic shift in the Co-III:II 11 redox potential, even in aqueous solution, but little cation selectivity is observed. Evidence for complex formation has been corroborated by Na-23 and Li-7 NMR spectroscopy and electrospray mass spectrometry.

Synthesis and characterization of mono- and bis-ligand zinc(II) and cadmium(II) complexes of the di-2-pyridylketone Schiff base of S-benzyl dithiocarbazate (Hdpksbz) and the X-ray crystal structures of the [Zn(dpksbz)2] and [Cd(dpksbz)NCS]2 complexes

New mono- and bis-chelated zinc(II) and cadmium(II) complexes of formula, [M(dpksbz)NCS] (dpksbz = anionic form of the di-2-pyridylketone Schiff base of S-benzyldithiocarbazate) and [M(dpksbz)(2)] (M = Zn-II, Cd-II) have been prepared and characterized. The structure of the bis-ligand complex, [Zn(dpksbZ)(2)] has been determined by X-ray diffraction. The complex has a distorted octahedral geometry in which the ligands are coordinated to the zinc(II) ion as uninegatively charged tridentate chelates via the thiolate sulfur atoms, the azomethine nitrogen atoms and the pyridine nitrogen atoms. The distortion from a regular octahedral geometry is attributed to the restricted bite angles of the Schiff base ligands. X-ray structural analysis shows that the [Cd(dpksbz)NCS](2) complex is a centrosymmetric dimer in which each of the cadmium(II) ions adopts a five-coordinate, approximately square-pyramidal configuration with the Schiff base acting as a tetradentate chelating agent coordinating a cadmium(II) ion via one of the pyridine nitrogen atoms, the azomethine nitrogen atom and the thiolate sulfur atom; the second pyridine nitrogen atom is coordinated to the other cadmium(II) ion of the dimer. The fifth coordination position around each cadmium(II) is occupied by an N-bonded thiocyanate ligand. (C) 2003 Elsevier Science Ltd. All rights reserved.