997 resultados para retardation factor
Resumo:
We previously isolated the SKN7 gene in a screen designed to isolate new components of the G1-S cell cycle transcription machinery in budding yeast. We have now found that Skn7 associates with Mbp1, the DNA-binding component of the G1-S transcription factor DSC1/MBF. SKN7 and MBP1 show several genetic interactions. Skn7 overexpression is lethal and is suppressed by a mutation in MBP1. Similarly, high overexpression of Mbp1 is lethal and can be suppressed by skn7 mutations. SKN7 is also required for MBP1 function in a mutant compromised for G1-specific transcription. Gel-retardation assays indicate that Skn7 is not an integral part of MBF. However, a physical interaction between Skn7 and Mbp1 was detected using two-hybrid assays and GST pulldowns. Thus, Skn7 and Mbp1 seem to form a transcription factor independent of MBF. Genetic data suggest that this new transcription factor could be involved in the bud-emergence process.
Resumo:
Tumor necrosis factor-related, activation-induced cytokine (TRANCE), a tumor necrosis factor family member, mediates survival of dendritic cells in the immune system and is required for osteoclast differentiation and activation in the skeleton. We report the skeletal phenotype of TRANCE-deficient mice and its rescue by the TRANCE transgene specifically expressed in lymphocytes. TRANCE-deficient mice showed severe osteopetrosis, with no osteoclasts, marrow spaces, or tooth eruption, and exhibited profound growth retardation at several skeletal sites, including the limbs, skull, and vertebrae. These mice had marked chondrodysplasia, with thick, irregular growth plates and a relative increase in hypertrophic chondrocytes. Transgenic overexpression of TRANCE in lymphocytes of TRANCE-deficient mice rescued osteoclast development in two locations in growing long bones: excavation of marrow cavities permitting hematopoiesis in the marrow spaces, and remodeling of osteopetrotic woven bone in the shafts of long bones into histologically normal lamellar bone. However, osteoclasts in these mice failed to appear at the chondroosseous junction and the metaphyseal periosteum of long bones, nor were they present in tooth eruption pathways. These defects resulted in sclerotic metaphyses with persistence of club-shaped long bones and unerupted teeth, and the growth plate defects were largely unimproved by the TRANCE transgene. Thus, TRANCE-mediated regulation of the skeleton is complex, and impacts chondrocyte differentiation and osteoclast formation in a manner that likely requires local delivery of TRANCE.
Resumo:
Kindling, an animal model of epilepsy wherein seizures are induced by subcortical electrical stimulation, results in the upregulation of neurotrophin mRNA and protein in the adult rat forebrain and causes mossy fiber sprouting in the hippocampus. Intraventricular infusion of a synthetic peptide mimic of a nerve growth factor domain that interferes with the binding of neurotrophins to their receptors resulted in significant retardation of kindling and inhibition of mossy fiber sprouting. These findings suggest a critical role for neurotrophins in both kindling and kindling-induced synaptic reorganization.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
The need to measure the response of the oculomotor system, such as ocular accommodation, accurately and in real-world environments is essential. New instruments have been developed over the past 50 years to measure eye focus including the extensively utilised and well validated Canon R-1, but in general these have had limitations such as a closed field-of-view, a poor temporal resolution and the need for extensive instrumentation bulk preventing naturalistic performance of environmental tasks. The use of photoretinoscopy and more specifically the PowerRefractor was examined in this regard due to its remote nature, binocular measurement of accommodation, eye movement and pupil size and its open field-of-view. The accuracy of the PowerRefractor to measure refractive error was on averaging similar, but more variable than subjective refraction and previously validated instrumentation. The PowerRefractor was found to be tolerant to eye movements away from the visual axis, but could not function with small pupil sizes in brighter illumination. The PowerRefractor underestimated the lead of accommodation and overestimated the slope of the accommodation stimulus response curve. The PowerRefractor and the SRW-5000 were used to measure the oculomotor responses in a variety of real-world environment: spectacles compared to single vision contract lenses; the use of multifocal contact lenses by pre-presbyopes (relevant to studies on myopia retardation); and ‘accommodating’ intraocular lenses. Due to the accuracy concerns with the PowerRefractor, a purpose-built photoretinoscope was designed to measure the oculomotor response to a monocular head-mounted display. In conclusion, this thesis has shown the ability of photoretinoscopy to quantify changes in the oculomotor system. However there are some major limitations to the PowerRefractor, such as the need for individual calibration for accurate measures of accommodation and vergence, and the relatively large pupil size necessary for measurement.
Resumo:
Background: Infants with fetal growth retardation (FGR) are prone to intestinal disorders. Objectives: Aim of the study was to determine the role of mucosal defense ability in formation of gut injury in infants with FGR. Materials and Methods: 44 premature infants who were admitted to the Neonatal Intensive Care Unit were divided into two groups: 20 infants with FGR (FGR group) and 24 appropriate-for-gestational age newborns (AGA group). Control group consisted of 22 premature infants who were delivered after uncomplicated pregnancy. Gut barrier function was evaluated by detecting serum intestinal trefoil factor (ITF) and intestinal fatty acid binding protein (IFABP). The level of serum IFABP and ITF was measured by using ELISA method. Results: FGR group showed significantly higher ITF concentration than AGA group on the first days of life (P ˂ 0.01). High level of ITF in the FGR group significantly declines up to 7th - 10th day of life (P ˂ 0.01). This reduction was accompanied by increase of IFABP which is a marker of ischemic intestinal mucosal injury. Correlation analyses showed that ITF had a negative correlation with IFABP. Conclusions: Infants with fetal growth retardation are characterized by a high level of ITF on the first days of life. This protects intestinal mucosa under hypoxic conditions. Its subsequent decline accompanied by an increase of IFABP reflects the depletion of Goblet cells to secret ITF causing damage to the integrity of intestinal mucosal barrier.