Association of the (CA)n repeat polymorphism of insulin-like growth factor-I and -202 A/C IGF-binding protein-3 promoter polymorphism with adult height in patients with severe growth hormone deficiency

A number of mathematical models for predicting growth and final height outcome have been proposed to enable the clinician to 'individualize' growth-promoting treatment. However, despite optimizing these models, many patients with isolated growth hormone deficiency (IGHD) do not reach their target height. The aim of this study was to analyse the impact of polymorphic genotypes [CA repeat promoter polymorphism of insulin-like growth factor-I (IGF-I) and the -202 A/C promoter polymorphism of IGF-Binding Protein-3 (IGFBP-3)] on variable growth factors as well as final height in severe IGHD following GH treatment. DESIGN, PATIENTS AND CONTROLS: One hundred seventy eight (IGF-I) and 167 (IGFBP-3) subjects with severe growth retardation because of IGHD were studied. In addition, the various genotypes were also studied in a healthy control group of 211 subjects.

Early-onset Crohn's disease is a risk factor for smaller final height.

OBJECTIVES Growth retardation is a frequent complication of paediatric inflammatory bowel disease (IBD). Only a few studies report the final height of these patients, with controversial results. We compared adult height of patients with paediatric IBD with that of patients with adult-onset disease. METHODS Height data of 675 women 19-44 years of age and 454 men 23-44 years of age obtained at inclusion in the Swiss IBD cohort study registry were grouped according to the age at diagnosis: (a) prepubertal (men≤13, women≤11 years), (b) pubertal (men 13-22, women 11-18 years) and (c) adult (men>22, women>18 years of age), and compared with each other and with healthy controls. RESULTS Male patients with prepubertal onset of Crohn's disease (CD) had significantly lower final height (mean 172±6 cm, range 161-182) compared with men with pubertal (179±6 cm, 161-192) or adult (178±7 cm, 162-200) age at onset and the general population (178±7 cm, 142-204). Height z-scores standardized against heights of the normal population were significantly lower in all patients with a prepubertal diagnosis of CD (-0.8±0.9) compared with the other patient groups (-0.1±0.8, P<0.001). Prepubertal onset of CD emerged as a risk factor for reduced final height in patients with prepubertal CD. No difference for final height was found between patients with ulcerative or unclassified IBD diagnosed at prepubertal, pubertal or adult age. CONCLUSION Prepubertal onset of CD is a risk for lower final height, independent of the initial disease location and the necessity for surgical interventions.

An examination of the relationship between maternal and neighborhood-level characteristics and intrauterine growth retardation in Harris County, Texas, 1999--2001

The persistence of low birth weight and intrauterine growth retardation (IUGR) in the United States has puzzled researchers for decades. Much of the work that has been conducted on adverse birth outcomes has focused on low birth weight in general and not on IUGR. Studies that have examined IUGR specifically thus far have focused primarily on individual-level maternal risk factors. These risk factors have only been able to explain a small portion of the variance in IUGR. Therefore, recent work has begun to focus on community-level risk factors in addition to the individual-level maternal characteristics. This study uses Social Ecology to examine the relationship of individual and community-level risk factors and IUGR. Logistic regression was used to establish an individual-level model based on 155, 856 births recorded in Harris County, TX during 1999-2001. IUGR was characterized using a fetal growth ratio method with race/ethnic and sex specific mean birth weights calculated from national vital records. The spatial distributions of 114,460 birth records spatially located within the City of Houston were examined using choropleth, probability and density maps. Census tracts with higher than expected rates of IUGR and high levels of neighborhood disadvantage were highlighted. Neighborhood disadvantage was constructed using socioeconomic variables from the 2000 U.S. Census. Factor analysis was used to create a unified single measure. Lastly, a random coefficients model was used to examine the relationship between varying levels of community disadvantage, given the set of individual-level risk factors for 152,997 birth records spatially located within Harris County, TX. Neighborhood disadvantage was measured using three different indices adapted from previous work. The findings show that pregnancy-induced hypertension, previous preterm infant, tobacco use and insufficient weight gain have the highest association with IUGR. Neighborhood disadvantage only slightly further increases the risk of IUGR (OR 1.12 to 1.23). Although community level disadvantage only helped to explain a small proportion of the variance of IUGR, it did have a significant impact. This finding suggests that community level risk factors should be included in future work with IUGR and that more work needs to be conducted. ^

Association of the Cell Cycle Transcription Factor Mbp1 with the Skn7 Response Regulator in Budding Yeast

We previously isolated the SKN7 gene in a screen designed to isolate new components of the G1-S cell cycle transcription machinery in budding yeast. We have now found that Skn7 associates with Mbp1, the DNA-binding component of the G1-S transcription factor DSC1/MBF. SKN7 and MBP1 show several genetic interactions. Skn7 overexpression is lethal and is suppressed by a mutation in MBP1. Similarly, high overexpression of Mbp1 is lethal and can be suppressed by skn7 mutations. SKN7 is also required for MBP1 function in a mutant compromised for G1-specific transcription. Gel-retardation assays indicate that Skn7 is not an integral part of MBF. However, a physical interaction between Skn7 and Mbp1 was detected using two-hybrid assays and GST pulldowns. Thus, Skn7 and Mbp1 seem to form a transcription factor independent of MBF. Genetic data suggest that this new transcription factor could be involved in the bud-emergence process.

Diverse roles of the tumor necrosis factor family member TRANCE in skeletal physiology revealed by TRANCE deficiency and partial rescue by a lymphocyte-expressed TRANCE transgene

Tumor necrosis factor-related, activation-induced cytokine (TRANCE), a tumor necrosis factor family member, mediates survival of dendritic cells in the immune system and is required for osteoclast differentiation and activation in the skeleton. We report the skeletal phenotype of TRANCE-deficient mice and its rescue by the TRANCE transgene specifically expressed in lymphocytes. TRANCE-deficient mice showed severe osteopetrosis, with no osteoclasts, marrow spaces, or tooth eruption, and exhibited profound growth retardation at several skeletal sites, including the limbs, skull, and vertebrae. These mice had marked chondrodysplasia, with thick, irregular growth plates and a relative increase in hypertrophic chondrocytes. Transgenic overexpression of TRANCE in lymphocytes of TRANCE-deficient mice rescued osteoclast development in two locations in growing long bones: excavation of marrow cavities permitting hematopoiesis in the marrow spaces, and remodeling of osteopetrotic woven bone in the shafts of long bones into histologically normal lamellar bone. However, osteoclasts in these mice failed to appear at the chondroosseous junction and the metaphyseal periosteum of long bones, nor were they present in tooth eruption pathways. These defects resulted in sclerotic metaphyses with persistence of club-shaped long bones and unerupted teeth, and the growth plate defects were largely unimproved by the TRANCE transgene. Thus, TRANCE-mediated regulation of the skeleton is complex, and impacts chondrocyte differentiation and osteoclast formation in a manner that likely requires local delivery of TRANCE.

A nerve growth factor peptide retards seizure development and inhibits neuronal sprouting in a rat model of epilepsy.

Kindling, an animal model of epilepsy wherein seizures are induced by subcortical electrical stimulation, results in the upregulation of neurotrophin mRNA and protein in the adult rat forebrain and causes mossy fiber sprouting in the hippocampus. Intraventricular infusion of a synthetic peptide mimic of a nerve growth factor domain that interferes with the binding of neurotrophins to their receptors resulted in significant retardation of kindling and inhibition of mossy fiber sprouting. These findings suggest a critical role for neurotrophins in both kindling and kindling-induced synaptic reorganization.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Assessment of the oculomotor response in human factor environments

The need to measure the response of the oculomotor system, such as ocular accommodation, accurately and in real-world environments is essential. New instruments have been developed over the past 50 years to measure eye focus including the extensively utilised and well validated Canon R-1, but in general these have had limitations such as a closed field-of-view, a poor temporal resolution and the need for extensive instrumentation bulk preventing naturalistic performance of environmental tasks. The use of photoretinoscopy and more specifically the PowerRefractor was examined in this regard due to its remote nature, binocular measurement of accommodation, eye movement and pupil size and its open field-of-view. The accuracy of the PowerRefractor to measure refractive error was on averaging similar, but more variable than subjective refraction and previously validated instrumentation. The PowerRefractor was found to be tolerant to eye movements away from the visual axis, but could not function with small pupil sizes in brighter illumination. The PowerRefractor underestimated the lead of accommodation and overestimated the slope of the accommodation stimulus response curve. The PowerRefractor and the SRW-5000 were used to measure the oculomotor responses in a variety of real-world environment: spectacles compared to single vision contract lenses; the use of multifocal contact lenses by pre-presbyopes (relevant to studies on myopia retardation); and ‘accommodating’ intraocular lenses. Due to the accuracy concerns with the PowerRefractor, a purpose-built photoretinoscope was designed to measure the oculomotor response to a monocular head-mounted display. In conclusion, this thesis has shown the ability of photoretinoscopy to quantify changes in the oculomotor system. However there are some major limitations to the PowerRefractor, such as the need for individual calibration for accurate measures of accommodation and vergence, and the relatively large pupil size necessary for measurement.

The Role of Mucosal Defense in Intestinal Injury of Infants With Fetal Growth Retardation

Background: Infants with fetal growth retardation (FGR) are prone to intestinal disorders. Objectives: Aim of the study was to determine the role of mucosal defense ability in formation of gut injury in infants with FGR. Materials and Methods: 44 premature infants who were admitted to the Neonatal Intensive Care Unit were divided into two groups: 20 infants with FGR (FGR group) and 24 appropriate-for-gestational age newborns (AGA group). Control group consisted of 22 premature infants who were delivered after uncomplicated pregnancy. Gut barrier function was evaluated by detecting serum intestinal trefoil factor (ITF) and intestinal fatty acid binding protein (IFABP). The level of serum IFABP and ITF was measured by using ELISA method. Results: FGR group showed significantly higher ITF concentration than AGA group on the first days of life (P ˂ 0.01). High level of ITF in the FGR group significantly declines up to 7th - 10th day of life (P ˂ 0.01). This reduction was accompanied by increase of IFABP which is a marker of ischemic intestinal mucosal injury. Correlation analyses showed that ITF had a negative correlation with IFABP. Conclusions: Infants with fetal growth retardation are characterized by a high level of ITF on the first days of life. This protects intestinal mucosa under hypoxic conditions. Its subsequent decline accompanied by an increase of IFABP reflects the depletion of Goblet cells to secret ITF causing damage to the integrity of intestinal mucosal barrier.

Growth Factor Stimulation Improves The Structure And Properties Of Scaffold-free Engineered Auricular Cartilage Constructs.

The reconstruction of the external ear to correct congenital deformities or repair following trauma remains a significant challenge in reconstructive surgery. Previously, we have developed a novel approach to create scaffold-free, tissue engineering elastic cartilage constructs directly from a small population of donor cells. Although the developed constructs appeared to adopt the structural appearance of native auricular cartilage, the constructs displayed limited expression and poor localization of elastin. In the present study, the effect of growth factor supplementation (insulin, IGF-1, or TGF-β1) was investigated to stimulate elastogenesis as well as to improve overall tissue formation. Using rabbit auricular chondrocytes, bioreactor-cultivated constructs supplemented with either insulin or IGF-1 displayed increased deposition of cartilaginous ECM, improved mechanical properties, and thicknesses comparable to native auricular cartilage after 4 weeks of growth. Similarly, growth factor supplementation resulted in increased expression and improved localization of elastin, primarily restricted within the cartilaginous region of the tissue construct. Additional studies were conducted to determine whether scaffold-free engineered auricular cartilage constructs could be developed in the 3D shape of the external ear. Isolated auricular chondrocytes were grown in rapid-prototyped tissue culture molds with additional insulin or IGF-1 supplementation during bioreactor cultivation. Using this approach, the developed tissue constructs were flexible and had a 3D shape in very good agreement to the culture mold (average error <400 µm). While scaffold-free, engineered auricular cartilage constructs can be created with both the appropriate tissue structure and 3D shape of the external ear, future studies will be aimed assessing potential changes in construct shape and properties after subcutaneous implantation.

Macrophage Cell Activation With Acute Apical Abscess Contents Determined By Interleukin-1 Beta And Tumor Necrosis Factor Alpha Production.

This clinical study has investigated the antigenic activity of bacterial contents from exudates of acute apical abscesses (AAAs) and their paired root canal contents regarding the stimulation capacity by levels of interleukin (IL)-1 beta and tumor necrosis factor alpha (TNF-α) throughout the root canal treatment against macrophage cells. Paired samples of infected root canals and exudates of AAAs were collected from 10 subjects. Endodontic contents were sampled before (root canal sample [RCS] 1) and after chemomechanical preparation (RCS2) and after 30 days of intracanal medication with calcium hydroxide + chlorhexidine gel (Ca[OH]2 + CHX gel) (RCS3). Polymerase chain reaction (16S rDNA) was used for detection of the target bacteria, whereas limulus amebocyte lysate was used to measure endotoxin levels. Raw 264.7 macrophages were stimulated with AAA exudates from endodontic contents sampled in different moments of root canal treatment. Enzyme-linked immunosorbent assays were used to measure the levels of TNF-α and IL-1 beta. Parvimonas micra, Porphyromonas endodontalis, Dialister pneumosintes, and Prevotella nigrescens were the most frequently detected species. Higher levels of endotoxins were found in samples from periapical exudates at RCS1 (P < .005). In fact, samples collected from periapical exudates showed a higher stimulation capacity at RCS1 (P < .05). A positive correlation was found between endotoxins from exudates with IL-1 beta (r = 0.97) and TNF-α (r = 0.88) production (P < .01). The significant reduction of endotoxins and bacterial species achieved by chemomechanical procedures (RCS2) resulted in a lower capacity of root canal contents to stimulate the cells compared with that at RCS1 (P < .05). The use of Ca(OH)2 + CHX gel as an intracanal medication (RCS3) improved the removal of endotoxins and bacteria from infected root canals (P < .05) whose contents induced a lower stimulation capacity against macrophages cells at RCS1, RCS2, and RCS3 (P < .05). AAA exudates showed higher levels of endotoxins and showed a greater capacity of macrophage stimulation than the paired root canal samples. Moreover, the use of intracanal medication improved the removal of bacteria and endotoxins from infected root canals, which may have resulted in the reduction of the inflammatory potential of the root canal content.

Vascular Endothelial Growth Factor Increases During Blood-brain Barrier-enhanced Permeability Caused By Phoneutria Nigriventer Spider Venom.

Phoneutria nigriventer spider accidental envenomation provokes neurotoxic manifestations, which when critical, results in epileptic-like episodes. In rats, P. nigriventer venom (PNV) causes blood-brain barrier breakdown (BBBb). The PNV-induced excitotoxicity results from disturbances on Na(+), K(+) and Ca(2+) channels and glutamate handling. The vascular endothelial growth factor (VEGF), beyond its angiogenic effect, also, interferes on synaptic physiology by affecting the same ion channels and protects neurons from excitotoxicity. However, it is unknown whether VEGF expression is altered following PNV envenomation. We found that adult and neonates rats injected with PNV showed immediate neurotoxic manifestations which paralleled with endothelial occludin, β-catenin, and laminin downregulation indicative of BBBb. In neonate rats, VEGF, VEGF mRNA, and Flt-1 receptors, glutamate decarboxylase, and calbindin-D28k increased in Purkinje neurons, while, in adult rats, the BBBb paralleled with VEGF mRNA, Flk-1, and calbindin-D28k increases and Flt-1 decreases. Statistically, the variable age had a role in such differences, which might be due to age-related unequal maturation of blood-brain barrier (BBB) and thus differential cross-signaling among components of the glial neurovascular unit. The concurrent increases in the VEGF/Flt-1/Flk-1 system in the cerebellar neuron cells and the BBBb following PNV exposure might imply a cytokine modulation of neuronal excitability consequent to homeostatic perturbations induced by ion channels-acting PNV neuropeptides. Whether such modulation represents neuroprotection needs further investigation.

Granulocyte Colony-stimulating Factor (g-csf) Positive Effects On Muscle Fiber Degeneration And Gait Recovery After Nerve Lesion In Mdx Mice.

G-CSF has been shown to decrease inflammatory processes and to act positively on the process of peripheral nerve regeneration during the course of muscular dystrophy. The aims of this study were to investigate the effects of treatment of G-CSF during sciatic nerve regeneration and histological analysis in the soleus muscle in MDX mice. Six-week-old male MDX mice underwent left sciatic nerve crush and were G-CSF treated at 7 days prior to and 21 days after crush. Ten and twenty-one days after surgery, the mice were euthanized, and the sciatic nerves were processed for immunohistochemistry (anti-p75(NTR) and anti-neurofilament) and transmission electron microscopy. The soleus muscles were dissected out and processed for H&E staining and subsequent morphologic analysis. Motor function analyses were performed at 7 days prior to and 21 days after sciatic crush using the CatWalk system and the sciatic nerve index. Both groups treated with G-CSF showed increased p75(NTR) and neurofilament expression after sciatic crush. G-CSF treatment decreased the number of degenerated and regenerated muscle fibers, thereby increasing the number of normal muscle fibers. The reduction in p75(NTR) and neurofilament indicates a decreased regenerative capacity in MDX mice following a lesion to a peripheral nerve. The reduction in motor function in the crushed group compared with the control groups may reflect the cycles of muscle degeneration/regeneration that occur postnatally. Thus, G-CSF treatment increases motor function in MDX mice. Nevertheless, the decrease in baseline motor function in these mice is not reversed completely by G-CSF.

Inhibition Of Tumor Necrosis Factor-alpha And Cyclooxigenase-2 By Isatin: A Molecular Mechanism Of Protection Against Tnbs-induced Colitis In Rats.

Isatin, an indole alkaloid has been shown to have anti-microbial, anti-tumor and anti-inflammatory effects. Due to its findings, we evaluated whether this alkaloid would have any effect on TNBS-induced colitis. Animals (male Unib:WH rats, aged 8 weeks old) were induced colitis through a rectal administration of 2,4,6-trinitrobenzene sulphonic acid using a catheter inserted 8 cm into the rectum of the animals. The rats were divided into two major groups: non-colitic and colitic. The colitic group was sub-divided into 6 groups (10 animals per group): colitic non-treated, Isatin 3; 6; 12.5; 18.75 and 25 mg/kg. Our main results showed that the oral treatment with Isatin 6 and 25 mg/kg were capable of avoiding the increase in TNF-α, COX-2 and PGE₂ levels when compared to the colitic non-treated group. Interestingly, the same doses (6 and 25 mg/kg) were also capable of preventing the decrease in IL-10 levels comparing with the colitic non-treated group. The levels of MPO, (an indirect indicator of neutrophil presence), were also maintained lower than those of the colitic non-treated group. Isatin also prevented the decrease of SOD activity and increase of GSH-Px and GSH-Rd activity as well as the depletion of GSH levels. In conclusion, both pre-treatments (6 and 25 mg/kg) were capable of protecting the gut mucosa against the injury caused by TNBS, through the combination of antioxidant and anti-inflammatory properties, which, together, showed a protective activity of the indole alkaloid Isatin.

Frequency Of The Allelic Variant C.1150t > C In Exon 10 Of The Fibroblast Growth Factor Receptor 3 (fgfr3) Gene Is Not Increased In Patients With Pathogenic Mutations And Related Chondrodysplasia Phenotypes.

Mutations in the FGFR3 gene cause the phenotypic spectrum of FGFR3 chondrodysplasias ranging from lethal forms to the milder phenotype seen in hypochondroplasia (Hch). The p.N540K mutation in the FGFR3 gene occurs in ∼70% of individuals with Hch, and nearly 30% of individuals with the Hch phenotype have no mutations in the FGFR3, which suggests genetic heterogeneity. The identification of a severe case of Hch associated with the typical mutation c.1620C > A and the occurrence of a c.1150T > C change that resulted in a p.F384L in exon 10, together with the suspicion that this second change could be a modulator of the phenotype, prompted us to investigate this hypothesis in a cohort of patients. An analysis of 48 patients with FGFR3 chondrodysplasia phenotypes and 330 healthy (control) individuals revealed no significant difference in the frequency of the C allele at the c.1150 position (p = 0.34). One patient carrying the combination `pathogenic mutation plus the allelic variant c.1150T > C' had a typical achondroplasia (Ach) phenotype. In addition, three other patients with atypical phenotypes showed no association with the allelic variant. Together, these results do not support the hypothesis of a modulatory role for the c.1150T > C change in the FGFR3 gene.