Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Application of inter simple sequence repeat (ISSR) markers to plant genetics

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.

Bursts of transposition from non-long terminal repeat retrotransposon families of the RTE clade in Schistosoma mansoni

The genus Schistosoma is composed of blood flukes that infect vertebrates, from which three species are major causative agents of human schistosomiasis, a tropical disease that affects more than 200 million people. Current models of the recent evolution of Schistosoma indicate multiple events of migration and speciation from an Asian ancestral species. Transposable elements are important drivers of genome evolution and have been hypothesised to have an important role in speciation. In this work, we describe a comprehensive inventory of Schistosoma mansoni and Schistosoma japonicum retrotransposons, based on their recently published genomic data. We find a considerable difference in retrotransposon representation between the two species (22% and 13%, respectively). A large part of this difference can be attributed to higher representation of two previously described families of S. mansoni retrotransposons (SR2 and Perere-3/SR3), compared with the representation of their closest relative families in S. japonicum. A more detailed analysis suggests that these two S. mansoni families were the subject of recent bursts of transposition that were not paralleled by their S. japonicum counterparts. We hypothesise that these bursts could be a consequence of the evolutionary pressure resulting from migration of Schistosoma from Asia to Africa and their establishment in this new environment, helping both speciation and adaptation. (C) 2009 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Short communication: Identification of subclinical cow mastitis pathogens in milk by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry

Subclinical mastitis is a common and easily disseminated disease in dairy herds. Its routine diagnosis via bacterial culture and biochemical identification is a difficult and time-consuming process. In this work, we show that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) allows bacterial identification with high confidence and speed (1 d for bacterial growth and analysis). With the use of MALDI-TOF MS, 33 bacterial culture isolates from milk of different dairy cows from several farms were analyzed, and the results were compared with those obtained by classical biochemical methods. This proof-of-concept case demonstrates the reliability of MALDI-TOF MS bacterial identification, and its increased selectivity as illustrated by the additional identification of coagulase-negative Staphylococcus species and mixed bacterial cultures. Matrix-assisted laser desorption-ionization mass spectrometry considerably accelerates the diagnosis of mastitis pathogens, especially in cases of subclinical mastitis. More immediate and efficient animal management strategies for mastitis and milk quality control in the dairy industry can therefore be applied.

The leucine-rich repeat as a protein recognition motif

Leucine-rich repeats (LRRs) are 20-29-residue sequence motifs present in a number of proteins with diverse functions. The primary function of these motifs appears to be to provide a versatile structural framework for the formation of protein-protein interactions. The past two years have seen an explosion of new structural information on proteins with LRRs. The new structures represent different LRR subfamilies and proteins with diverse functions, including GTPase-activating protein rna 1 p from the ribonuclease-inhibitor-like subfamily; spliceosomal protein U2A', Rab geranylgeranyltransferase, internalin B, dynein light chain 1 and nuclear export protein TAP from the SDS22-like subfamily; Skp2 from the cysteine-containing subfamily; and YopM from the bacterial subfamily. The new structural information has increased our understanding of the structural determinants of LRR proteins and our ability to model such proteins with unknown structures, and has shed new light on how these proteins participate in protein-protein interactions.

Targeting of EBNA1 for rapid intracellular degradation overrides the inhibitory effects of the Gly-Ala repeat domain and restores CD8+T cell recognition

Epstein-Barr virus (EBV)-encoded nuclear antigen 1 (EBNA1) includes a unique glycine-alanine repeat domain that inhibits the endogenous presentation of cytotoxic T lymphocyte (CTL) epitopes through the class I pathway by blocking proteasome-dependent degradation of this antigen. This immune evasion mechanism has been implicated in the pathogenesis of EBV-associated diseases. Here, we show that cotranslational ubiquitination combined with N-end rule targeting enhances the intracellular degradation of EBNA1, thus resulting in a dramatic reduction in the half-life of the antigen. Using DNA expression vectors encoding different forms of ubiquitinated EBNA1 for in vivo studies revealed that this rapid degradation, remarkably, leads to induction of a very strong CTL response to an EBNA1-specific CTL epitope. Furthermore, this targeting also restored the endogenous processing of HLA class I-restricted CTL epitopes within EBNA1 for immune recognition by human EBV-specific CTLs. These observations provide, for the first time, evidence that the glycine-alanine repeat-mediated proteasomal block on EBNA1 can be reversed by specifically targeting this antigen for rapid degradation resulting in enhanced CD8+ T cell-mediated recognition in vitro and in vivo.

Gulliver, a long terminal repeat retrotransposon from the genome of the oriental blood fluke Schistosoma japonicum

We characterized the consensus sequence and structure of a long terminal repeat (LTR) retrotransposon from the genome of the human blood fluke, Schistosoma japonicum, and have earned this element, Gulliver. The full length, consensus Gulliver LTR retrotransposon was 4788 bp, and it was flanked at its 5'- and 3'-ends by LTRs of 259 bp. Each LTR included RNA polymerase II promoter sequences, a CAAT signal and a TATA box, Gulliver exhibited features characteristic of a functional LTR retrotransposon including two read through (termination) ORFs encoding retroviral gag and pol proteins of 312 and 1071 amino acid residues, respectively. The gag ORF encoded motifs conserved in nucleic acid binding proteins, while the pol ORF encoded conserved domains of aspartic protease, reverse transcriptase (RT), RNaseH and integrase, in that order, a pol pattern conserved in the gypsy lineage of LTR retrotransposons. Whereas the sequence and structure of Gulliver was similar to that of gypsy, phylogenetic analysis revealed that Gulliver did not group particularly closely with the gypsy family. Rather, its closest relatives were a LTR retrotransposon from Caenorhabditis elegans, mag from Bombyx mori and, to a lesser extent, easel from the salmon Oncorhynchus keta. Dot blot hybridizations indicated that Gulliver was present at between 100 and several thousand copies in the S. japonicum genome, and Southern hybridization analysis suggested its probable presence in the genome of Schistosoma mansoni. Transcripts encoding the RT domain of Gulliver were detected by RT-PCR in larval and adult stages of S. japonicum, indicating that (at least) the RT domain of Gulliver is transcribed. This is the first report of the sequence and structure of an LTR retrotransposon from any schistosome or indeed from any species belonging to the phylum Platyhelminthes. (C) 2001 Elsevier Science B.V. All rights reserved.

pido, a non-long terminal repeat retrotransposon of the chicken repeat 1 family from the genome of the Oriental blood fluke, Schistosoma japonicum

A newly described non-long terminal repeat (non-LTR) retrotransposon element was isolated from the genome of the Oriental schistosome, Schistosoma japonicum. At least 1000 partial copies of the element, which was named pido, were dispersed throughout the genome of S. japonicum. As is usual with non-LTR retrotransposons, it is expected that many pido elements will be 5'-truncated. A consensus sequence of 3564 bp of the truncated pido element was assembled from several genomic fragments that contained pido-hybridizing sequences. The sequence encoded part of the first open reading frame (ORF), the entire second ORF and, at its 3'-terminus, a tandemly repetitive, A-rich (TA(6)TA(5)TA(8)) tail, The ORF1 of pido encoded a nucleic acid binding protein and ORF2 encoded a retroviral-like polyprotein that included apurinic/apyrimidinic endonuclease (EN) and reverse transcriptase (RT) domains, in that order. Based on its sequence and structure, and phylogenetic analyses of both the RT and EN domains, pido belongs to the chicken repeat 1 (CR1)-like lineage of elements known from the chicken, turtle, puffer fish, mosquitoes and other taxa. pido shared equal similarity with CRI from chicken, an uncharacterized retrotransposon from Caenorhabditis elegans and SR1 (a non-LTR retrotransposon) from the related blood fluke Schistosoma mansoni; the level of similarity between pido and SR1 indicated that these two schistosome retrotransposons were related but not orthologous. The findings indicate that schistosomes have been colonized by at least two discrete CRI-like elements. Whereas pido did not appear to have a tight target site specificity, at least one copy of pido has inserted into the 3'-untranslated region of a protein-encoding gene (GeriBank AW736757) of as yet unknown identity. mRNA encoding the RT of pido was detected by reverse transcription-polymerase chain reaction in the egg, miracidium. and adult developmental stages of S. japonicum, indicating that the RT domain was transcribed and suggesting that pido was replicating actively and mobile within the S. japonicum genome. (C) 2002 Elsevier Science B.V. All rights reserved.

Reverse transcriptase activity and untranslated region sharing of a new RTE-like, non-long terminal repeat retrotransposon from the human blood fluke, Schistosoma japonicum

A new RTE-like, non-long terminal repeat retrotransposon, termed SjR2, from the human blood fluke, Schistosoma japonicum, is described. SjR2 is similar to3.9 kb in length and is constituted of a single open reading frame encoding a polyprotein with apurinic/apyrimidinic endonuclease and reverse transcriptase domains. The open reading frame is bounded by 5'- and 3'-terininal untranslated regions and, at its 3-terminus, SjR2 bears a short (TGAC)(3) repeat. Phylogenetic analyses based on conserved domains of reverse transcriptase or endonuclease revealed that SjR2 belonged to the RTE clade of non-long terminal repeat retrotransposons. Further, SjR2 was homologous, but probably not orthologous, to SR2 front the African blood fluke, Schistosoma mansoni; this RTE-like family of non-long terminal repeat retrotransposons appears to have arisen before the divergence of the extant schistosome species. Hybridisation analyses indicated that similar to 10,000 copies of SjR2 were dispersed throughout the S. japonicum chromosomes, accounting for up to 14% of the nuclear genome. Messenger RNAs encoding the reverse transcriptase and endonuclease domains of SjR2 were detected in several developmental stages of the schistosome, indicating that the retrotransposon was actively replicating within the genome of the parasite. Exploration of the coding and non-coding regions of SjR2 revealed two notable characteristics. First, the recombinant reverse transcriptase domain of SjR2 expressed in insect cells primed reverse transcription of SjR2 mRNA in vitro. By contrast, recombinant SjR2-endonuclease did not appear to cleave schistosome or plasmid DNA. Second, the 5'-untranslated region of SjR2 was >80% identical to the 3-untranslated region of a schistosome heat shock protein-70 gene (hsp-70) in the antisense orientation, indicating that SjR2-like elements were probably inserted into the non-coding regions of ancestral S. japonicum HSP-70, probably after the species diverged from S. mansoni. (C) 2002 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved.

Development of triplet repeat primed PCR (TP-PCR) technique as a support of molecular test in Machado-Joseph disease

Dissertação de Mestrado, Ciências Biomédicas, 3 de Fevereiro de 2016, Universidade dos Açores.

O repeat viewing no contexto do metacinema

Partindo da explicação daquilo que neste ensaio se entende por “metacinema” e a sua relevância como discurso autoral sobre a sétima arte, aborda-se o fenómeno do visionamento múltiplo de uma mesma obra (aspeto conhecido em inglês como “repeat viewing”). Este fenómeno permite um contato privilegiado entre o meta espetador, propenso a aderir em maior grau aos metafilmes, e o meta realizador, inclinado a construir uma carreira em torno da execução dos mesmos. Em causa está o visionamento e o fabrico de obras, direta ou indiretamente, especializadas no universo cinematográfico. A mediação do dispositivo cinematográfico na projeção em sala ou a apropriação de novas e cada vez mais versáteis tecnologias de captação e reprodução audiovisual permite transformar o vidente cinéfilo num utilizador compulsivo, conferindo ao cinema atualmente uma dimensão háptica que ele não detinha da mesma forma anteriormente. O espetador apropria-se de obras criadas por outrem, atribuindo-lhes uma nova forma e um novo sentido, mas dentro de um contexto cinéfilo. Inversamente, o criador é voluntariamente apropriado pela indústria, permitindo o consumo de si mesmo nas edições em videograma e trabalhando internamente as obras e os seus mecanismos formais e narrativos para geraram maior e mais multiplicadas formas de consumo junto dos espetadores. Assim se fomenta uma jornada que não é do herói, mas sim do vidente. Para concluir, defende-se que a maior acessibilidade fílmica permitida pela disseminação de novas janelas de consumo cinematográfico incrementa o repeat viewing e uma apropriação cada vez maior das obras, mas em contrapartida, pode desencadear a nulidade do discurso metacinematográfico e o esboroar do metacinema como tal.