Semiquantitative RT-PCR measurement of gene expression in rat tissues including a correction for varying cell size and number

Background: Current methodology of gene expression analysis limits the possibilities of comparison between cells/tissues of organs in which cell size and/or number changes as a consequence of the study (e.g. starvation). A method relating the abundance of specific mRNA copies per cell may allow direct comparison or different organs and/or changing physiological conditions. Methods: With a number of selected genes, we analysed the relationship of the number of bases and the fluorescence recorded at a present level using cDNA standards. A lineal relationship was found between the final number of bases and the length of the transcript. The constants of this equation and those of the relationship between fluorescence and number of bases in cDNA were determined and a general equation linking the length of the transcript and the initial number of copies of mRNA was deduced for a given pre-established fluorescence setting. This allowed the calculation of the concentration of the corresponding mRNAs per g of tissue. The inclusion of tissue RNA and the DNA content per cell, allowed the calculation of the mRNA copies per cell. Results: The application of this procedure to six genes: Arbp, cyclophilin, ChREBP, T4 deiodinase 2, acetyl-CoA carboxylase 1 and IRS-1, in liver and retroperitoneal adipose tissue of food-restricted rats allowed precise measures of their changes irrespective of the shrinking of the tissue, the loss of cells or changes in cell size, factors that deeply complicate the comparison between changing tissue conditions. The percentage results obtained with the present methods were essentially the same obtained with the delta-delta procedure and with individual cDNA standard curve quantitative RT-PCR estimation. Conclusion: The method presented allows the comparison (i.e. as copies of mRNA per cell) between different genes and tissues, establishing the degree of abundance of the different molecular species tested.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Análise da expressão dos genes STEAP1 e STEAP2 em adenocarcinomas de próstata por RT-PCR quantitativa em tempo real

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Guideline to reference gene selection for quantitative real-time PCR

Today, quantitative real-time PCR is the method of choice for rapid and reliable quantification of mRNA transcription. However, for an exact comparison of mRNA transcription in different samples or tissues it is crucial to choose the appropriate reference gene. Recently glyceraldehyde 3-phosphate dehydrogenase and P-actin have been used for that purpose. However, it has been reported that these genes as well as alternatives, like rRNA genes, are unsuitable references, because their transcription is significantly regulated in various experimental settings and variable in different tissues. Therefore, quantitative real-time PCR was used to determine the mRNA transcription profiles of 13 putative reference genes, comparing their transcription in 16 different tissues and in CCRF-HSB-2 cells stimulated with 12-O-tetradecanoylphorbol-13-acetate and ionomycin. Our results show that Classical reference genes are indeed unsuitable, whereas the RNA polymerase II gene was the gene with the most constant expression in different tissues and following stimulation in CCRF-HSB-2 cells. (C) 2003 Elsevier Inc. All rights reserved.

Specific detection of enterovirus 71 directly from clinical specimens using real-time RT-PCR hybridization probe assay

Enterovirus 71 (EV71) is one of the main causative agents of hand, foot and mouth disease (HFMD) in young children. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. Thus, rapid detection of the virus is required to enable measures to be implemented in preventing widespread transmission. Based on primers and probes targeting at the VP1 region, a real-time reverse-transcriptase polymerase chain reaction (RT-PCR) hybridization probe assay was developed for specific detection of EV71 from clinical specimens. Quantitative analysis showed that the assay was able to detect as low as 5 EV71 viral copies and EV71 was detected from 46 of the 55 clinical specimens obtained from pediatric patients suffering from HFMD during the period from 2000 to 2003 in Singapore. This study showed that the single tube real-time RT-PCR assay developed in this study can be applied as a rapid and sensitive method for specific detection of EV71 directly from clinical specimens. (c) 2005 Elsevier Ltd. All rights reserved.

Rapid detection of bovine coronavirus by a semi-nested RT-PCR

Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.

Detection of dengue virus in saliva and urine by real time RT-PCR

Early diagnosis of dengue virus (DENV) infection is important for patient management and control of dengue outbreaks. The objective of this study was to analyze the usefulness of urine and saliva samples for early diagnosis of DENV infection by real time RT-PCR. Two febrile patients, who have been attended at the General Hospital of the School of Medicine of Ribeirao Preto, Sao Paulo University were included in the study. Serum, urine and saliva samples collected from both patients were subjected to real time RT-PCR for DENV detection and quantification. Dengue RNA was detected in serum, urine and saliva samples of both patients. Patient 1 was infected with DENV-2 and patient 2 with DENV-3. Data presented in this study suggest that urine and saliva could be used as alternative samples for early diagnosis of dengue virus infection when blood samples are difficult to obtain, e.g.,in newborns and patients with hemorrhagic syndromes.

PMCA1 mRNA expression in rat aortic myocytes: A real-time RT-PCR study

The plasmalemmal Ca2+ adenosine triphosphatase (PMCA) is a key regulator of Ca2+ efflux in vascular smooth muscle. In these studies are developed a realtime reverse transcriptase-polymerase chain reaction (real-time RT-PCR) assay for assessing PMCA1 mRNA levels in rat primary cultured aortic myocytes. This assay detected fetal bovine serum-induced increases in PMCA1 mRNA (relative to 18S rRNA) 4, 8, and 24 h after stimulation. Early fetal bovine serum-induced increases in PMCA1 mRNA were insensitive to the Ca2+ channel blockers nifedipine, flunarizine, and SKF-96365. These studies demonstrate the feasibility of real-time RT-PCR to assess mRNA levels of PMCA1 and illustrate dynamic regulation of this Ca2+ pump isoform in rat primary cultured aortic myocytes, (C) 2000 Academic Press.

miRNA analysis of prostate cancer by quantitative real time PCR: Comparison between formalin-fixed paraffin embedded and fresh-frozen tissue

Objective: Micro RNA (miRNA) is a class of small noncoding RNA that plays a major role in the regulation of gene expression, which has been related to cancer behavior. The possibility of analyzing miRNA from the archives of pathology laboratories is exciting, as it allows for large retrospective studies. Formalin is the most common fixative used in the surgical pathology routine, and its promotion of nucleic acid degradation is well known. Our aim is to compare miRNA profiles from formalin-fixed paraffin embedded (FFPE) tissues with fresh-frozen prostate cancer tissues. Methods: The expression of 14 miRNAs was determined by quantitative real time polymerase chain reaction (qRT-PCR) in 5 paired fresh-frozen and FFPE tissues, which were representative of prostate carcinoma. Results: There was a very good correlation of the miRNA expression of miR-let7c and miR-32 between the fresh-frozen and FFPE tissues, with Pearson`s correlation coefficients of 0.927 (P = 0.023) and 0.960 (P = 0.010), respectively. For the remaining miRNAs, the correlation was good with Spearman correlation coefficient of 0.638 (P < 0.001). Conclusion: Analysis of miRNAs from routinely processed and stored FFPE prostate tissue is feasible for some miRNAs using qRT-PCR. Further studies should be conducted to confirm the reliability of using stock tissues for miRNA expression determination. (C) 2011 Elsevier Inc. All rights reserved.

Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs

The detection of replicative intermediate RNAs as markers of active replication of RNA viruses is an essential tool to investigate pathogenesis in acute viral infections, as well as in their long-term sequelae. In this regard, strand-specific PCR has been used widely to distinguish (-) and (+) enteroviral RNAs in pathogenesis studies of diseases such as dilated cardiomyopathy. It has been generally assumed that oligonucleotide-primed reverse transcription of a given RNA generates only the corresponding specific cDNA, thus assuring the specificity of a PCR product amplified from it. Nevertheless, such assumed strand-specificity is a fallacy, because falsely primed cDNAs can be produced by RNA reverse transcription in the absence of exogenously added primers, (cDNA(primer)(-)), and such falsely primed cDNAs are amplifiable by PCR in the same way as the correctly primed cDNAs. Using as a prototype the coxsackievirus B5 (CVB5), a (+) strand RNA virus, it was shown that cDNA(primer)(-) renders the differential detection of viral (-) and (+) RNAs by conventional PCR virtually impossible, due to gross non-specificity. Using in vitro transcribed CVB5 RNAs (+) and (-), it was shown that cDNA(primer)(-) could be removed effectively by magnetic physical separation of correctly primed biotinylated cDNA. Such strategy enabled truly strand-specific detection of RNA (-) and (+), not only for CVB5, but also for other non-polio enteroviruses. These findings indicate that previous conclusions supporting a role for the persistence of actively replicating enterovirus in the pathogenesis of chronic myocarditis should be regarded with strong skepticism and purification of correctly primed cDNA should be used for strand-specific PCR of viral RNA in order to obtain reliable information on this important subject. (C) 2009 Elsevier B.V. All rights reserved.

Use of the real time RT-PCR for immune related gene expression quantitation in experimentally infected Neospora caninum bovine calves

Neospora caninum is one of the main causes of abortion and natimortality in cattle. Host immune defense is capable to inhibit tachyzoite activity during acute infection, but there is no action against bradyzoites in tissue cysts. Activation and modulation of this response is controlled by cell mediators. The real-time RT-PCR technique was employed to detect some of those mediators during N. caninum infection. Holstein and Nelore calves intramuscularly infected with tachyzoites and uninfected controls were slaughtered at the sixth day post-infection and popliteal lymph node, liver and brain cortex samples were analyzed. Real-time RT-PCR detected gene expression in all tissues. No significant variation of GAPDH gene expression was detected among groups, its amplification efficiency was similar to the other genes tested and it was used as the endogenous control for the analysis. Comparisons between infected and uninfected groups allowed the relative gene expression quantification. IFN-gamma and TNF-alpha genes showed increased expression in some samples. iNOS and TGF-beta 1 genes had some non-significant variations and IL-4 and IL-10 stayed pratically inaltered.

Multiplex semi-nested RT-PCR with exogenous internal control for simultaneous detection of bovine coronavirus and group A rotavirus

Neonatal calf diarrhea is a multi-etiology syndrome of cattle and direct detection of the two major agents of the syndrome, group A rotavirus and Bovine coronavirus (BCoV) is hampered by their fastidious growth in cell culture. This study aimed at developing a multiplex semi-nested RT-PCR for simultaneous detection of BCoV (N gene) and group A rotavirus (VP1 gene) with the addition of an internal control (mRNA ND5). The assay was tested in 75 bovine feces samples tested previously for rotavirus using PAGE and for BCoV using nested RT-PCR targeted to RdRp gene. Agreement with reference tests was optimal for BCoV (kappa = 0.833) and substantial for rotavirus detection (kappa = 0.648). the internal control, ND5 mRNA, was detected successfully in all reactions. Results demonstrated that this multiplex semi-nested RT-PCR was effective in the detection of BCoV and rotavirus, with high sensitivity and specificity for simultaneous detection of both viruses at a lower cost, providing an important tool for studies on the etiology of diarrhea in cattle. (C) 2010 Elsevier B.V. All rights reserved.

Development of a real-time RT-PCR assay for plasma membrane calcium ATPase isoform 1 (PMCA1) mRNA levels in a human breast epithelial cell line.

The plasma membrane Ca2+ pump is a key regulator of cytosolic free Ca2+. Recent studies have demonstrated the dynamic expression of the plasma membrane Ca2+ pump in a variety of cell types. Furthermore, alterations in plasma membrane calcium pump activity have now been implicated in human disease. In this study, the development of a technique to quantitatively assess mRNA expression of the human plasma membrane Ca2+ ATPase (PMCA1) isoform of the plasma membrane Ca2+ pump, using a real-time reverse transcriptase-polymerase chain reaction (real-time RT-PCR) assay in a human breast epithelial cell line (MCF-7) is described. The sequences of the PMCA1 primers and probe for real-time RT-PCR are presented. The results also indicate that PMCA1 mRNA can be normalized to both 18S ribosomal RNA (18S rRNA) and human glyceraldehyde-3-phosphate dehydrogenase (hGAPDH) in MCF-7 cells. Real-time RT-PCR will be most useful in assessing PMCA1 mRNA expression in cases where only low amounts of RNA are available and/or when numerous samples must be assessed simultaneously. (C) 2001 Elsevier Science Inc. All rights reserved.